Molecular Plant Advance Access originally published online on October 31, 2007
Molecular Plant 2008 1(1):118-128; doi:10.1093/mp/ssm012
| ||||||||||||||||||||||||||||||||||||||||||||||||||||
© The Author 2007. Published by Oxford University Press on behalf of CSPP and IPPE, SIBS, CAS.
Interaction of the Arabidopsis UV-B-Specific Signaling Component UVR8 with Chromatin
Plant Science Group, Division of Biochemistry and Molecular Biology, Institute of Biomedical and Life Sciences, Bower Building, University of Glasgow, Glasgow G12 8QQ, UK
1 To whom correspondence should be addressed. E-mail G.Jenkins{at}bio.gla.ac.uk, tel. +44 141 330 5906, fax +44 141 330 4447.
 |
Abstract |
|---|
 TOP Abstract INTRODUCTIONRESULTSDISCUSSIONMETHODSChIP Antibodies |
|---|
Arabidopsis UV RESISTANCE LOCUS8 (UVR8) is a UV-B-specific signaling component that regulates expression of a range of genes concerned with UV protection. Here, we investigate the interaction of UVR8 with chromatin. Using antibodies specific to UVR8 in chromatin immunoprecipitation (ChIP) assays with wild-type plants, we show that native UVR8 binds to chromatin in vivo. Similar experiments using an anti-GFP antibody with plants expressing a GFP–UVR8 fusion show that UVR8 associates with a relatively small region of chromatin containing the HY5 gene. UVR8 interacts with chromatin containing the promoter regions of other genes, but not with all the genes it regulates. UV-B is not required for the interaction of UVR8 with chromatin because association with several gene loci is observed in the absence of UV-B. Pull-down assays demonstrate that UVR8 associates with histones in vivo and competition experiments indicate that the interaction is preferentially with histone H2B. ChIP experiments using antibodies that recognize specific histone modifications indicate that the UV-B-stimulated transcription of some genes may be correlated with histone modification. In particular, the ELIP1 promoter showed a significant enrichment of diacetyl histone H3 (K9/K14) following UV-B exposure. These findings increase understanding of the interaction of the key UV-B-specific regulator UVR8 with chromatin.
|
INTRODUCTION |
|---|
|
TOPAbstractINTRODUCTIONRESULTSDISCUSSIONMETHODSChIP Antibodies |
|---|
UV-B wavelengths (280–320 nm) are a minor component of sunlight but have a major impact on terrestrial ecosystems because of their high energy (McKenzie et al., 2003; Caldwell et al., 2007). UV-B has divergent effects on plants. At one extreme, it can damage macromolecules such as DNA and cause the production of reactive oxygen species (ROS) that have the potential to inhibit cellular activities (Brosché and Strid, 2003; Frohnmeyer and Staiger, 2003; Jansen et al., 1998; Jenkins and Brown, 2007). As a result, UV-B may impair photosynthesis, membrane transport and other physiological processes and may cause tissue necrosis (Dai et al., 1997; Jansen et al., 1998). However, UV-B can also act as a regulatory signal that affects morphogenesis and controls UV-protective responses (Frohnmeyer and Staiger, 2003; Jansen et al., 1998; Jenkins and Brown, 2007; Paul and Gwynne-Jones, 2003; Ulm and Nagy, 2005). Numerous studies have shown that the effects of UV-B involve the differential expression of a wide range of genes (Brown et al., 2005; Casati et al., 2004, 2006; Izaguirre et al., 2003; Ulm et al., 2004). It is therefore important to understand the mechanisms of plant UV-B perception and signal transduction and how these processes lead to the regulation of gene activity.
The effects of UV-B vary with the wavelength and fluence rate of exposure. In general, shorter UV-B wavelengths and higher fluence rates are most likely to cause damage (Dai et al., 1997; Kim et al., 1998). In addition, the effect on the plant will be conditioned by the extent of prior acclimation to UV-B, which leads to UV protection. High fluence rates of UV-B generate ROS (Allan and Fluhr, 1997; Barta et al., 2004; Dai et al., 1997) and promote the synthesis of signaling molecules involved in wound and defence responses, such as jasmonic acid and ethylene (A-H-Mackerness et al., 1999). In consequence, high fluence rates of UV-B stimulate the expression of several genes characteristic of stress, defence, and wound responses. These responses to high fluence rates of UV-B are not mediated by UV-B-specific pathways.
In contrast to its potentially damaging effects, UV-B provides a regulatory signal that promotes UV protection (Frohnmeyer and Staiger, 2003; Jenkins and Brown, 2007; Ulm and Nagy, 2005). It is well established that UV-B stimulates the synthesis of flavonoids that provide a UV-absorbing sunscreen in epidermal tissues in conjunction with other phenolic compounds (Bornman et al., 1997; Hahlbrock and Scheel, 1989; Li et al., 1993; Stapleton and Walbot, 1994). This protective mechanism involves the stimulation of transcription by UV-B of various genes encoding flavonoid biosynthesis enzymes (Hahlbrock and Scheel, 1989; Jenkins et al., 2001; Weisshaar and Jenkins, 1998). In addition, UV-B promotes expression of a number of other UV-protective genes, including those involved in repairing DNA damage and combating oxidative stress (Brown et al., 2005; Ulm et al., 2004). The UV-protective gene expression responses can be induced by low, non-damaging fluence rates of UV-B, indicating that they are mediated by regulatory, photomorphogenic signaling pathways (Frohnmeyer and Staiger, 2003; Jenkins and Brown, 2007; Ulm and Nagy, 2005). Low fluence UV-B signals also regulate morphogenic processes such as extension growth (Ballaré et al., 1995; Boccalandro et al., 2001; Jansen et al., 1998; Kim et al., 1998).
The mechanisms of UV-B perception and signal transduction in regulatory UV-B responses are poorly understood. These responses do not appear to involve co-option of stress/defence/wound signaling pathways (Jenkins et al., 2001; Jenkins and Brown, 2007), and studies with mutants indicate that they are not mediated by the major classes of plant regulatory photoreceptors (Boccalandro et al., 2001; Brosché and Strid, 2003; Jenkins and Brown, 2007; Ulm et al., 2004; Wade et al., 2001). Furthermore, studies with mutants altered in DNA repair indicate that the responses are not mediated by DNA damage signaling (Boccalandro et al., 2001; Kim et al., 1998; Ulm et al., 2004). Action spectra show that wavelengths between 295 and 305 nm are most effective in regulatory UV-B responses (Ensminger, 1993), but no UV-B-specific photoreceptor has ever been discovered.
Recent work has identified a UV-B-specific regulatory pathway that controls the expression of genes concerned with UV protection. This pathway involves the Arabidopsis UV RESISTANCE LOCUS8 (UVR8) protein (Brown et al., 2005; Jenkins and Brown, 2007). Kliebenstein et al. (2002) first isolated the uvr8 mutant in a screen for UV-sensitive plants. The mutant fails to induce expression of the CHALCONE SYNTHASE (CHS) gene in response to UV-B and has reduced levels of flavonoids. Brown et al. (2005) showed that the impairment in CHS expression was specific to UV-B since the mutant retained induction in response to several other stimuli. Transcriptomic analysis revealed that UVR8 regulates a set of genes with important roles in UV protection and the repair of UV damage, thus explaining the UV sensitivity of the uvr8 mutant (Brown et al., 2005). UVR8 was found to regulate expression of the gene encoding the HY5 transcription factor specifically in response to UV-B and microarray analysis showed that HY5 regulated a range of genes controlled by the UVR8 pathway. Recent experiments indicate that HY5 and the related HYH transcription factor act redundantly to control expression of probably all the UVR8 target genes (B.A. Brown and G.I. Jenkins, unpublished data). The hy5 mutant is very sensitive to UV-B, indicating that HY5 has a key role in UV protection (Brown et al., 2005; Oravecz et al., 2006).
UVR8 has sequence similarity and putative structural similarity to the human RCC1 protein that is the guanine nucleotide exchange factor for the small GTP-binding protein Ran (Kliebenstein et al., 2002). Brown et al. (2005) reported that UVR8 has very little exchange activity, indicating that it has a different function from RCC1. UVR8 is present in both the cytoplasm and the nucleus. Chromatin immunoprecipitation (ChIP) experiments with transgenic plants expressing a GFP–UVR8 fusion showed that the fusion was associated with chromatin containing the HY5 promoter, suggesting that the interaction of UVR8 with chromatin facilitated transcriptional activation of the HY5 gene. Here, we examine in more detail the interaction of UVR8 with chromatin. We show that native UVR8 associates with chromatin containing additional UVR8-regulated genes and that the interaction is not restricted to promoter regions. In addition, we show that the binding of UVR8 to chromatin does not require UV-B exposure. Further, we show that the interaction with chromatin is principally via histone H2B. ChIP experiments suggest that histone modification may be important in the regulation of transcription by UV-B, but no clear pattern is seen with studies of different genes.
|
RESULTS |
|---|
|
TOPAbstractINTRODUCTIONRESULTSDISCUSSIONMETHODSChIP Antibodies |
|---|
Native UVR8 Binds to Chromatin
Previously, we showed that a GFP–UVR8 fusion expressed in Arabidopsis via the CaMV 35S promoter (35Spro) associated with chromatin (Brown et al., 2005). To counter any possibility that either the level or spatial localization of expression driven by the heterologous promoter, or the presence of the GFP tag gave rise to aberrant results, we wanted to establish whether native UVR8 interacted with chromatin.
We wished to obtain antibodies that specifically recognized UVR8 and could be used in ChIP experiments with wild-type plants. For the production of specific antisera, we selected two regions of UVR8 that are not conserved in other proteins—one in the N-terminal region, MAEDMAADEVTAPP (UVR8N) and one in the C-terminal region, VPDETGLTDGSSKGN (UVR8C). These peptides were synthesized and peptide antibodies produced and affinity purified. The specificity of the antisera was tested by immunoblotting using Arabidopsis plant extracts. As shown in Figure 1A, UVR8N and UVR8C recognize native UVR8 of the correct molecular mass in wild-type plants. Furthermore, both antibodies are specific for UVR8, as no cross-reacting band is detected in the uvr8-1 mutant. Both antibodies were effective in immunoprecipitation using in-vitro-expressed GST–UVR8 (data not shown).
|
The antibodies were used for ChIP assays using either wild-type plants or uvr8-1 expressing 35Spro:GFP–UVR8. A GFP antibody was used as a positive control. The immunoprecipitated DNA fragments were assayed for the presence of the HY5 promoter and for the control ACTIN2 gene using PCR. As shown in Figure 1B, the anti-GFP antibody immunoprecipitated chromatin containing HY5 promoter DNA but not ACTIN2 DNA from 35Spro:GFP–UVR8 plants, consistent with previous findings (Brown et al., 2005). Equivalent results were obtained using the UVR8C antibody with wild-type plants, demonstrating that native UVR8 associates with chromatin containing the HY5 promoter region but not the control ACTIN2 gene. The UVR8N antibody was much less effective in ChIP and only faint PCR products were occasionally detected (Figure 1B; see also Figure 3).
|
|
Binding of UVR8 Is Not Restricted to the HY5 Promoter Region
Our previous ChIP experiments showed that GFP–UVR8 associates with chromatin containing the HY5 promoter region (–331 to +23) (Brown et al., 2005). We wished to establish whether UVR8 interacted only with this region or more widely at the HY5 locus and to start to delimit the region of UVR8 association. We therefore carried out ChIP analysis on the HY5 genomic locus. We used PCR to test whether the specific regions of genomic DNA shown in Figure 2A were present in chromatin immunoprecipitated from 35Spro:GFP–UVR8 plants using a GFP antibody. The results (Figure 2B) show that GFP–UVR8 associates with chromatin containing the HY5 coding sequence and with sequences just downstream of the coding sequence. However, PCR products corresponding to regions further downstream (+5522 to +5824) or upstream (–6604 to –6019) of HY5 were not obtained. We conclude that UVR8 associates with a relatively small genomic region around the HY5 locus and that its interaction is not confined to the promoter region.
UVR8 Associates with Chromatin Containing Several UV-B-Regulated Genes
To date, UVR8 has been shown to associate with chromatin containing one gene—HY5. However, microarray analysis has identified 72 genes (at a 5% false discovery rate) that are regulated by UVR8 (Brown et al., 2005). We therefore examined whether UVR8 interacts with chromatin containing additional genes using ChIP–PCR. Experiments were undertaken with both wild-type and 35Spro:GFP–UVR8 plants using anti-UVR8 and anti-GFP antibodies. As shown in Figure 3A, UVR8 associates with chromatin containing the promoter regions of two genes—MYB12, which encodes a transcription factor that regulates CHS and flavonol biosynthesis genes, and CRYD, which encodes a putative chloroplast photolyase. The regulation of MYB12 expression by UVR8 was not detected in the microarray analysis at the 5% false discovery rate, but is shown here using RT–PCR assays of transcript levels (Figure 3B). However, we could not detect association of UVR8 with the promoter regions of either HYH or CHS. It should be noted that for all four genes, very similar results were obtained for native UVR8 and GFP–UVR8. Thus, UVR8 appears to interact with chromatin containing the promoter regions of several, but not all, UVR8-regulated genes.
UV-B Is Not Required for UVR8 Association with Chromatin
Little is known about the mechanisms through which UV-B regulates UVR8. Since UVR8 associates with chromatin, one possibility is that UV-B affects chromatin binding in some way. We therefore examined whether the association of UVR8 with chromatin at target gene loci is affected by UV-B exposure. Plants were grown in a low fluence rate of white light lacking UV-B and then exposed to UV-B for 4 h. The ChIP assay was used to determine whether GFP–UVR8 interacted with the promoters of the HY5, CRYD and MYB12 genes. The results, presented in Figure 4, show that GFP–UVR8 was present in chromatin containing the promoters of all three genes both before and after UV-B exposure. Thus, UV-B is not required for the interaction of UVR8 with chromatin.
|
UVR8 Interacts with Histone H2B
Previously, we reported that UVR8 binds in vitro to a histone-agarose matrix (Brown et al., 2005). We wanted to extend this observation to establish whether UVR8 interacted with histones in vivo and to determine whether interaction was via a specific histone. For these experiments, we used uvr8-1 plants expressing GFP–UVR8 from the native UVR8 promoter rather than the 35S promoter. In-vivo immunoprecipitation was performed on a chromatin-enriched preparation from UVR8pro:GFP–UVR8 plants using a GFP antibody immobilized on microbeads. The immunoblots, presented in Figure 5A, show that by pulling down GFP–UVR8, we also co-immunoprecipitate histones. The presence of histones was detected using an anti-histone H3 antibody and a strong band was observed. Wild-type and 35Spro:GFP plants were used as controls and, in both cases, only a very faint band was detected with the anti-histone H3 antibody, representing background binding to the GFP beads.
|
To test whether GFP–UVR8 interacted preferentially with specific histones, we carried out in-vitro competition experiments. In-vitro translated myc-tagged UVR8 was pre-incubated with purified histones in 20-fold excess followed by incubation with histone-agarose. Figure 5B shows that H2B is the only histone that can compete effectively to diminish the binding of myc-UVR8 to histone-agarose. These results suggest that UVR8 binds to chromatin via an interaction with histone H2B.
Histone Modification May Be Involved in UV-B Regulation of Transcription
Epigenetic control via histone modification is known to play an important role in eukaryotic transcriptional regulation (Kouzarides, 2007; Li et al., 2007). Numerous studies, including in plants (Benvenuto et al., 2002; Benhamed et al., 2006; Loidl, 2004; Ng et al., 2006) have shown that acetylation of specific lysine residues in the N-terminal regions of particular histones is often associated with actively transcribed genes, whereas deacetylation is often associated with transcriptional repression. We wished to investigate whether such modification could be important in the control of gene expression by UV-B. Plants were grown in a low fluence rate of white light lacking UV-B and then exposed to UV-B for 4 h. We performed ChIP experiments on these plants using antibodies that recognize specific histone modifications: anti-diacetyl H3 (K9/K14) and anti-hyperacetylated H4 (K5/K8/K12/K16). We examined, using PCR, whether the promoter regions of several UV-B-stimulated genes were present in the immunoprecipitated chromatin fragments. In particular, we wanted to see if there was an increase in the presence of acetylated histones in chromatin containing the promoters of UV-B-regulated genes following UV-B exposure. The results, presented in Figure 6, show that for most genes, there is no significant difference in chromatin association before and after UV-B illumination. However, the promoter of the EARLY LIGHT INDUCED PROTEIN 1 (ELIP1) gene shows a substantial relative enrichment in chromatin containing diacetyl H3 (K9/K14) following UV-B exposure. Interestingly, this gene was found to have the largest fold-difference in transcript accumulation following UV-B illumination in our microarray analysis (Brown et al., 2005). Similarly, although to a less dramatic extent, the HYH promoter shows increased representation in chromatin containing diacetyl H3 (K9/K14) after UV-B treatment. Furthermore, the HY5 promoter showed relative enrichment in chromatin containing diacetyl H3 (K9/K14) and hyperacetylated H4 (K5/K8/K12/K16) following UV-B.
|
|
DISCUSSION |
|---|
|
TOPAbstractINTRODUCTIONRESULTSDISCUSSIONMETHODSChIP Antibodies |
|---|
UV-B stimulates expression of a range of genes whose products confer UV protection and hence promote plant survival in sunlight. UVR8 is required for these responses and is the only known UV-B-specific signaling component in plants. It is therefore important to understand how UV-B regulates UVR8 and how UVR8 mediates the regulation of gene expression. Our previous research (Brown et al., 2005) indicated that the interaction of UVR8 with chromatin is key to understanding UVR8 function. Our hypothesis is that UV-B modifies UVR8 in some way and that UVR8, most likely acting with other proteins in association with chromatin, controls the ability of transcription factors to regulate UVR8-target genes such as HY5. In turn, HY5, HYH, and possibly other transcription factors are required to stimulate transcription of the set of genes regulated by UVR8 specifically in response to UV-B. In the present study, we extend our understanding of the interaction of UVR8 with chromatin and the regulation of transcription by UV-B.
Our previous report that UVR8 interacted with chromatin was based on experiments with a GFP–UVR8 fusion expressed in transgenic uvr8-1 mutant plants via the heterologous 35S promoter. Here, we show that native UVR8 associates with chromatin in wild-type plants. These experiments required the use of antibodies that recognize UVR8 in ChIP assays. These antibodies are specific for UVR8 because no cross-reacting band is seen in uvr8-1 (Figure 1). It is interesting that the antibodies do not detect any band in this mutant because the uvr8-1 allele has only a 15-bp deletion in the UVR8 coding sequence (Kliebenstein et al., 2002). It appears that this small deletion makes the UVR8 protein unstable.
The anti-UVR8N antibody is less effective in recognizing UVR8 than anti-UVR8C because it appears to be less sensitive. Anti-UVR8N was occasionally effective in ChIP assays (see Figure 3), whereas anti-UVR8C gave consistent results. Similarly, a longer exposure was needed in Western blot analyses to see a signal with anti-UVR8N compared to anti-UVR8C. The ChIP results obtained using anti-UVR8C with wild-type plants were highly consistent with those obtained using the anti-GFP antibody with 35Spro:GFP–UVR8 plants, indicating that both methods can be used reliably to identify regions of chromatin where UVR8 interacts.
The only information obtained previously about the site of UVR8 interaction with chromatin was that it associated with the HY5 promoter region (Brown et al., 2005). Here, we demonstrate that UVR8 interacts more widely at the HY5 locus. Although we have not fine-mapped the region of association, the data indicate that UVR8 binds chromatin containing the HY5 coding sequence and regions both upstream and downstream, but it does not bind further than about 5 kbp from the HY5 transcription start site. We suggest that UVR8 forms part of a multi-protein complex that associates with chromatin at the HY5 locus and is involved in regulating transcription.
The ChIP data obtained in this study extend our knowledge of the chromatin targets of UVR8. HY5 and HYH are key effectors of the UVR8 pathway and act redundantly to control most, if not all, of the UVR8 target genes (Brown et al., 2005; B.A. Brown and G.I. Jenkins, unpublished data). Thus, a simple model is that UVR8 might interact only with chromatin at the HY5 and HYH loci and that these factors might then regulate UVR8 target genes independently of UVR8 association. However, the present ChIP data refute this model. First, we did not obtain any evidence that UVR8 interacts with chromatin containing the putative HYH promoter region. Although we cannot exclude the possibility that UVR8 associates with chromatin outside the region of the HYH locus amplified by our primers, we would expect a protein complex containing UVR8 to be present over the transcription initiation site. UVR8 regulates expression of the MYB12 gene and associates with chromatin containing the MYB12 promoter, but this factor regulates only a small subset of UVR8 target genes. Second, the data show that UVR8 associates with chromatin containing at least one downstream target gene, CRYD and not just transcription factor genes. However, it appears that UVR8 does not interact with chromatin containing all its target genes because, in addition to HYH, we found no evidence that UVR8 interacts with chromatin containing the CHS promoter. Thus, at present, it is not possible to explain why UVR8 associates with some loci and not others. The situation is complicated by the fact that some UVR8 target genes are involved in the regulation of others. For instance, HY5 and MYB12 are known to regulate the CHS promoter (Ang et al., 1998; Mehrtens et al., 2005) and HY5 is reported to associate with the HYH promoter (Lee et al., 2007). A fuller understanding of the interaction of UVR8 with chromatin targets will require more comprehensive information, such as would be obtained from ChIP-on-chip analysis.
Since UVR8 mediates the regulation of gene expression specifically in response to UV-B, it is important to understand how UV-B regulates UVR8. Recent research from this laboratory shows that brief UV-B exposure promotes the nuclear accumulation of UVR8 (Kaiserli and Jenkins, 2007). However, even when UVR8 is constitutively localized in the nucleus by addition of a nuclear localization signal, UV-B exposure is still required to stimulate expression of UVR8 target genes. We therefore wished to determine whether UV-B might modulate the interaction of UVR8 with chromatin. The ChIP experiments (Figure 4) indicate that UV-B is not required to recruit UVR8 to chromatin. UVR8 is present on chromatin containing three gene loci in low fluence rate white light lacking UV-B. The ChIP data are semi-quantitative rather than absolutely quantitative, so we cannot rule out the possibility that UV-B treatment increases the extent of UVR8 association. However, it appears that UV-B does not regulate UVR8 function via differential binding to chromatin and some other mechanism is most likely involved. It may be that UVR8 interacts with different proteins before and after UV-B exposure that act as co-repressors or co-activators of transcription.
Our previous in-vitro binding assays (Brown et al., 2005) indicated that GFP–UVR8 interacts with chromatin via histones. The present experiments show that GFP–UVR8 interacts with histones in vivo because the anti-GFP antibody pulls down Arabidopsis proteins containing GFP–UVR8 and histones (Figure 5). The competition experiments indicate that UVR8 most likely binds to chromatin through interaction with histone H2B, as H2B was most effective at reducing the interaction of myc-tagged UVR8 with histone-agarose. Similar experiments indicated that DET1 interacts with chromatin via H2B (Benvenuto et al., 2002). UVR8 has 50% sequence similarity with human Regulator of Chromatin Condensation 1, which interacts with chromatin via H2B and H2A (Nemergut et al., 2001).
It is well established in eukaryotic systems that regulatory proteins are recruited to specific regions of chromatin through a ‘histone code’ (Kouzarides, 2007; Li et al., 2007). Evidence that histone modification is involved in plant responses to light is starting to accumulate (Benvenuto et al., 2002; Benhamed et al., 2006; Chua et al., 2003). It is therefore possible that UVR8 targets genes whose nucleosomes contain particular histone variants. Moreover, UV-B may introduce specific modifications to histones that facilitate the opening of chromatin structure and initiation of transcription. Among the various modifications that have been studied, histone acetylation at specific lysines is closely correlated with transcriptional activity. The particular histone H3 and H4 acetylations examined in the present study are known to be associated with actively transcribed genes (Kouzarides, 2007; Loidl, 2004; Ng et al., 2006). Although UVR8 interacts principally with H2B, the nature and modification of other histones in the nucleosome are likely to influence UVR8 interaction. At present, less is known about modifications to H2B that influence transcriptional regulation than modifications to other histones, although ubiquitylation is reported to be important (Li et al., 2007; Tanny et al., 2007).
No information has previously been reported on histone modification in relation to UV-B responses in plants and we therefore attempted to examine whether the UV-B induction of transcription was correlated with histone acetylation. Although no consistent pattern was seen with the genes studied, there is evidence for some genes that histone acetylation is correlated with increased transcription in response to UV-B (Figure 6). In particular, the data for ELIP1 and diacetyl-histone H3 (K9/K14) modification are quite striking. It may be significant that this gene shows a very large fold-induction by UV-B (Brown et al., 2005; B.A. Brown and G.I. Jenkins, unpublished data). Some of the other genes studied show a basal level of transcription in white light lacking UV-B and this might explain why a strong correlation between UV-B exposure and histone acetylation was not observed. Since there are a number of different histone modifications and histone variants, it may be that further investigation will reveal additional evidence of a relationship between UV-B signaling and histone modification.
|
METHODS |
|---|
|
TOPAbstractINTRODUCTIONRESULTSDISCUSSIONMETHODSChIP Antibodies |
|---|
Plant Material and Treatment
Seeds of wild-type Arabidopsis thaliana ecotype Landsberg erecta (L. er) were obtained from the European Arabidopsis Stock Centre (Nottingham, UK). The uvr8-1 mutant allele in the L. er background (Kliebenstein et al., 2002) was obtained from Dr Dan Kliebenstein (University of Davis, CA, USA). The 35Spro:GFP–UVR8 line in the uvr8-1 background was described by Brown et al. (2005). In the UVR8pro:GFP–UVR8 line (also in uvr8-1), the 35S promoter was replaced by the –1426 to +163 genomic sequence upstream of the UVR8 coding sequence (Kaiserli and Jenkins, 2007). The 35Spro:GFP line (in L. er) was provided by Robert Sablowski (John Innes Centre, Norwich, UK).
Plants were grown on compost (John Innes No. 2) at 21°C for 14 d in 120 µmol m–2 s–1 continuous white light (Osram warm white fluorescent tubes), except for the experiments shown in Figures 3B, 4 and 6
, where they were grown for 21 d in 20 µmol m–2 s–1 continuous white light. All plants were exposed to 3 µmol m–2 s–1 UV-B for 4 h. UV-B was provided by UVB–313 UV fluorescent tubes (Q-Panel Co, USA) covered with cellulose acetate (West Design Products, London, UK), which was changed every 24 h. This source has maximal emission at 313 nm and no emission below 290 nm. Fluence rates were measured either using a Skye RS232 meter (Skye Instruments, Powys, UK) equipped with a Quantum sensor or SKU 430 sensor (280–315 nm) or using a Macam spectroradiometer (model SR9910, Macam Photometrics, Livingston, UK).
ChIP
ChIP assays were carried out as described by Gendrel et al. (2002). Arabidopsis plants were harvested and subjected to 1% (w/v) formaldehyde cross-linking for 15 min under vacuum. The cross-linking was stopped by adding glycine to a final concentration of 0.125 M for 5 min. Plants were rinsed with water and ground in liquid nitrogen to obtain a fine powder. The powder was re-suspended in buffer containing 0.4 M sucrose, 10 mM Tris-HCl, pH 8, 10 mM MgCl2, 5 mM β-mercaptoethanol, 0.1 mM PMSF and one protease inhibitor mix tablet (Complete Mini, 11836153001, Roche, UK) added per 30 ml of buffer. The solution was then filtered through Miracloth and centrifuged for 20 min at 4000 g. Pellets were suspended in a buffer containing 0.25 M sucrose, 10 mM Tris-HCl, pH 8, 10 mM MgCl2, 1% (v/v) Triton X-100, 5 mM β-mercaptoethanol, 0.1 mM PMSF and protease inhibitor. The suspensions were centrifuged for 10 min at 12 000 g. Pellets were re-suspended in a buffer containing 1.7 M sucrose, 10 mM Tris-HCl, pH 8, 0.15% (v/v) Triton X-100, 2 mM MgCl2, 5 mM β-mercaptoethanol, 0.1 mM PMSF and protease inhibitor. Suspensions were centrifuged through a layer of the same buffer for 1 h at 16 000 g.
The chromatin-enriched pellets were re-suspended in nuclei lysis buffer containing 50 mM Tris-HCl, pH 8, 10 mM EDTA, 1% (w/v) SDS and protease inhibitor. Nuclear pellets were sonicated six times for 10 s on ice using a sonicator (Soniprep 150, Sanyo) and centrifuged. The supernatants containing chromatin fragments were diluted 10-fold with ChIP dilution buffer (1.1% (v/v) Triton X–100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8, 167 mM NaCl). After preclearing for 1 h at 4°C with 100 µl protein A Dynabeads (100.02, Invitrogen), the immunoprecipitation assays were carried out at 4°C overnight with the appropriate antibody or without antibody (mock). Immunoprecipitates were collected after incubation with 100 µl protein A Dynabeads. After sequential washes, immunoprecipitates were eluted twice with 250 µl of fresh elution buffer (1% (w/v) SDS, 0.1 M NaHCO3). Samples were then reverse cross-linked at 65°C under high-salt conditions (0.2 M NaCl) for at least 5 h. Proteins were removed by a proteinase K treatment and DNA was recovered by phenol/chloroform extraction and ethanol precipitation. Purified DNA was re-suspended in 30 µl TE buffer, pH 8.
|
ChIP Antibodies |
|---|
|
TOPAbstractINTRODUCTIONRESULTSDISCUSSIONMETHODSChIP Antibodies |
|---|
Antibodies against UVR8 were custom-made in rabbits (Sigma-Aldrich) using two synthetic peptides. MAEDMAADEVTAPP is situated in the N-terminal region (UVR8N), while VPDETGLTDGSSKGN is situated in the C-terminal region of UVR8 (UVR8C). Both antibodies were affinity purified.
For the ChIP assays, the UVR8N and UVR8C antibodies were used at a dilution of 1/500. The polyclonal GFP antibody (Invitrogen A-11122) was used at a dilution of 1/100. The anti-diacetyl histone H3 (Upstate Biotechnology 06-599) and anti-hyperacetylated H4 (Upstate Biotechnology 06-946) antibodies both were used at a dilution of 1/100.
ChIP PCR and Primers
Immunoprecipitated DNA was analyzed by PCR using the following primers:
Promoter region of MYB12: forward 5'GGAGGATCCGGCGTAAATC3’; reverse 5'TACTGAGTGACAGACAACAGA3'.
Promoter region of CRYD: forward 5'AGACTGTAGAGTATAGACTTATT3’; reverse 5'GAGAGAGGAGAAGAGAGCG3'.
Promoter region of CHS: forward 5'CCCACCATTCAATCTTGGTA3’; reverse 5'TATAGTATACACCAACTTGGG3'.
Promoter region of HYH: forward 5'CATTAGTTAGCTGTCTTTATACA3’; reverse 5'AGAGGTAAGAGGTTGAAGAGA3'.
Promoter region of ELIP1: forward 5'GGCCAAATACACGAGTCAGT3’; reverse 5'GAGTAACGAATGATCTTACGTA3'.
Promoter region (–331 to +23) of HY5: forward 5'TTGGTTTATGGCGGCTATAAA3’; reverse 5'TGGCTACCGCCGTCAGAT3'.
Upstream region (–6604 to –6019) of HY5: forward 5'AATAGCCTCTACCGCCGTG3’; reverse 5'TGTGTCCACTGAACTAGAACA3'.
Downstream region (+2290 to +2755) of HY5: forward 5'CGCTTTCTAGCATCTTGCGA3’; reverse 5'ATTAGTAGGATCAGTATCACAG3'.
Downstream region (+5522 to +5824) of HY5: forward 5'CTGTAACTCTTGTCCCTTAAG3’; reverse 5'CTCGAATTTACTGTTAGGTCG3'.
Coding region (+219 to + 799) of HY5: forward 5'GCTGCAAGCTCTTTACCATC3’; reverse 5'AGCATCTGGTTCTCGTTCTG3'.
ACTIN2 gene: forward 5'GTTGGGATGAACCAGAAGGA3’; reverse 5'CTTACAATTTCCCGCTCTGC3'.
UBQ5 gene: forward 5'CTTGAAGACGGCCGTACCCTC3’; reverse 5'CGCTGAACCTTTCAAGATCCATCG3'.
PCR reactions were performed on 0.5 or 1 µl of the immunoprecipitated DNA in 25 µl final volume. PCR conditions were as follows: 5 min at 95°C, 35 or 40 cycles (HY5 only) with 30 s at 95°C, 30 s at 57°C, 45 s at 72°C and finally 5 min at 72°C. Data were obtained for at least three completely independent experiments.
Quantification of ChIP-PCR products was carried out using the Quantity One® software (BioRad). Normalized signals were obtained by subtraction of the mock control signal from the experimentally obtained value. Division of the normalized signal by the input signal yielded the RE (relative enrichment) for each gene and antibody. Data were obtained for four completely independent experiments.
RT–PCR Analysis
Total RNA was extracted from leaf tissue by the RNeasy Plant Mini Kit (Qiagen, UK) according to the manufacturer's instructions. cDNA synthesis and RT–PCR for control ACTIN2 transcripts were performed as described by Brown et al. (2005). MYB12 transcript levels were assayed in similar reaction mixtures using the protocol: 3 min at 95°C; 30 s at 95°C, 30 s at 62°C, and 45 s at 72°C for 30 cycles; 5 min at 72°C. The PCR products were visualized by electrophoresis on agarose gels containing ethidium bromide. The primers used for MYB12 and ACTIN2 amplification were as described by Mehrtens et al. (2005) and Fontaine et al. (2002), respectively.
Protein Gel Blot Analysis
Plant extracts were prepared on ice by grinding in micro-extraction buffer: 20 mM HEPES, pH 7.8, 450 mM NaCl, 50 mM NaF, 200 µM EDTA, 0.1 mM PMSF, 1 mM DTT, 25% (v/v) glycerol and one protease inhibitor mix tablet (Complete Mini, 11836153001, Roche, UK) added per 10 ml of buffer. After freeze–thaw treatments, samples were centrifuged at 4°C for 10 min at 16 000 g. Supernatant was collected and a Bradford protein assay (500-0006, BioRad) was carried out.
Samples (30 µg) were loaded on a 12.5% SDS-PAGE gel. After transfer to nitrocellulose membrane (162-0115, BioRad), ponceau staining (P3504, Sigma-Aldrich; 0.1% w/v in 1% v/v acetic acid) was carried out. After removing the stain, the membrane was blocked at room temperature for at least 1 h using 8% (w/v) milk powder in TBS containing 0.1% (v/v) Triton X-100 (TBS-T). Antibodies were then incubated, at room temperature, with the membrane in 8% (w/v) milk powder in TBS-T for at least 1 h at a dilution of 1/5000 for all the antibodies. The anti-GFP antibody used for immunoblots was a mouse monoclonal (Clontech 632375). After several washes, a secondary antibody conjugated with horseradish peroxidase (Promega anti-mouse W401B for the GFP antibody and Promega anti-rabbit W402B for UVR8 and H3 antibodies) was incubated with the membrane for at least 1 h, at room temperature in 8% (w/v) milk powder in TBS-T. After sequential stringent washes, proteins were detected using the ECL+ system (RPN2132, Amersham). Data shown are representative of three independent experiments.
Immunoprecipitation Using GFP Microbeads
Chromatin-enriched samples were prepared using the ChIP method stopped before the sonication step. The chromatin pellets were re-suspended in lysis buffer (150 mM NaCl, 1% (v/v) Triton-X100, 50 mM Tris-HCl, pH 8). Chromatin-enriched samples (600 µg) were incubated for 30 min on ice with 50 µl anti-GFP microbeads (µMac beads 130-091-370, Myltenyi Biotec). A microcolumn was equilibrated with 200 µl lysis buffer. The chromatin/microbead samples were applied onto the column and unbound material was allowed to run through. After four washes with 200 µl of lysis buffer and one wash with Tris-HCl, pH 7.5, 20 µl of elution buffer (0.1 M triethylamine, pH 11.8, 0.1% (w/v) Triton X-100) was applied onto the column and incubated for 5 min at room temperature. An extra 50 µl of elution buffer was added and the eluate was collected in a tube containing 3 µl of 1 M MES, pH 3 for neutralization. The eluates were analyzed by SDS-PAGE and Western blot. The data presented are representative of three independent experiments.
Competition Experiments
The full-length UVR8 cDNA was subcloned in PGBK-T7 (630303, Clontech) as an EcoRI–SalI fragment. Myc-UVR8 protein was produced in vitro using the TnT®-coupled wheat-germ extract system (L4330, Promega). Twenty-five µl of TnT® wheat-germ extract were mixed with 2 µl of reaction buffer, 1 µl RNA polymerase, 1 µl amino acid mixture, 1 µl RNAsin (N211A, Promega), 2 µl of 0.5 µg/µl of DNA in a final volume of 50 µl and incubated for 90 min at 30°C. Three µl of the reaction was added to 200 µg histone H2A (1073826, Roche) or H2B (1073818, Roche) or H3 (11036289, Roche) or H4 (516767, Roche) or 50 µg of a mixture of the histones in PBS with 0.1% (v/v) Nonidet® P40. Myc-UVR8 binding to 10 µg of histone-agarose (18008540530, MPBIO) was performed overnight at 4°C. After sequential washes, samples were loaded on a 10% SDS-PAGE gel and a Western blot was carried out, as described above, using an anti-c-myc antibody (11667149001, Roche) at a dilution of 1/1000. Data shown are representative of five independent experiments.
Accession Numbers
Arabidopsis Genome Initiative locus identifiers for the genes mentioned in this article are as follows: UVR8 At5g63860, HY5 At5g11260, HYH At3g17609, MYB12 At2g47460, CRYD At5g24850, CHS At5g13930, ELIP1 At3g22840, UBQ5 At3g62250, ACTIN2 At3g18780.
|
Acknowledgements |
|---|
We would like to thank Eirini Kaiserli for providing the GFP–UVR8 lines and for cDNA used in the RT–PCR experiments, Dan Kliebenstein (UC Davis, USA) for providing uvr8-1 mutant seeds, and Robert Sablowski and Clare Lister (John Innes Centre) for seeds of the 35Spro:GFP line. We would like to thank members of the Jenkins and Christie laboratories for helpful discussions. C.C. was supported by a UK Biotechnology and Biological Sciences Research Council Research Grant to G.I.J.
-
A-H-Mackerness S, Surplus SL, Blake P, John CF, Buchanan–Wollaston V, Jordan BR, Thomas B. Ultraviolet-B-induced stress and changes in gene expression in Arabidopsis thaliana: role of signalling pathways controlled by jasmonic acid, ethylene and reactive oxygen species. Plant Cell & Environment (1999) 22:1413–1423.[CrossRef]
Allan AC, Fluhr R. Two distinct sources of elicited reactive oxygen species in tobacco epidermal cells. Plant Cell (1997) 9:1559–1572.[Abstract]
Ang L-H, Chattopadhyay S, Wei N, Oyama T, Okada K, Batschauer A, Deng X-W. Molecular interaction between COP1 and HY5 defines a regulatory switch for light control of Arabidopsis development. Mol. Cell (1998) 1:213–222.[CrossRef][Web of Science][Medline]
Ballaré CL, Barnes PW, Flint SD. Inhibition of hypocotyl elongation by ultraviolet-B radiation in de-etiolating tomato seedlings. 1. The photoreceptor. Physiologia Plantarum (1995) 93:584–592.[CrossRef]
Barta C, Kalai T, Hideg K, Vass I, Hideg E. Differences in the ROS-generating efficacy of various ultraviolet wavelengths in detached spinach leaves. Functional Plant Biology (2004) 31:23–28.[CrossRef][Web of Science]
Benhamed M, Bertrand C, Servet C, Zhou D-X. Arabidopsis GCN5, HD1, and TAF1/HAF2 interact to regulate histone acetylation required for light-responsive gene expression. Plant Cell (2006) 18:2893–2903.
Benvenuto G, Formiggini F, Leflamme P, Malakhov M, Bowler C. The photomorphogenesis regulator DET1 binds the amino–terminal tail of histone H2B in a nucleosome context. Curr. Biol. (2002) 12:1529–1534.[CrossRef][Web of Science][Medline]
Boccalandro HE, Mazza CA, Mazzella MA, Casal JJ, Ballaré CL. Ultraviolet B radiation enhances a phytochrome-B-mediated photomorphogenic response in Arabidopsis. Plant Physiol (2001) 126:780–788.
Bornman JF, Reuber S, Cen Y-P, Weissenböck G. Ultraviolet radiation as a stress factor and the role of protective pigments. In Plants and UV-B: Responses to Environmental Change. Lumsden PJ, ed. (1997) Cambridge: Cambridge University Press. 157–168.
Brosché N, Strid A. Molecular events following perception of ultraviolet-B radiation by plants. Physiologia Plantarum (2003) 117:1–10.[CrossRef]
Brown BA, Cloix C, Jiang GH, Kaiserli E, Herzyk P, Kliebenstein DJ, Jenkins GI. A UV-B-specific signaling component orchestrates plant UV protection. Proc. Natl Acad. Sci. USA (2005) 102:18225–18230.
Caldwell MM, Bornman JF, Ballaré CL, Flint SD, Kulandaivelu G. Terrestrial ecosystems, increased solar ultraviolet radiation, and interactions with other climate change factors. Photochem. Photobiol. Sci. (2007) 6:252–266.[CrossRef][Web of Science][Medline]
Casati P, Walbot V. Rapid transcriptome responses of maize (Zea mays) to UV-B in irradiated and shielded tissues. Genome Biology (2004) 5:R16.[CrossRef][Medline]
Casati P, Stapleton AE, Blum JE, Walbot V. Genome-wide analysis of high-altitude maize and gene knockdown stocks implicates chromatin remodelling proteins in response to UV-B. Plant J. (2006) 46:613–627.[CrossRef][Web of Science][Medline]
Chua YL, Watson LA, Gray JC. The transcriptional enhancer of the pea plastocyanin gene associates with the nuclear matrix and regulates gene expression through histone acetylation. Plant Cell (2003) 15:1468–1479.
Dai QJ, Yan B, Huang SB, Liu XZ, Peng SB, Miranda MLL, Chavez AQ, Vergara BS, Olszyk DM. Response of oxidative stress defense systems in rice (Oryza sativa) leaves with supplemental UV-B radiation. Physiologia Plantarum (1997) 101:301–308.[CrossRef]
Ensminger PA. Control of development in plants and fungi by far-UV radiation. Physiologia Plantarum (1993) 88:501–508.[CrossRef]
Fontaine V, Hartwell J, Jenkins GI, Nimmo HG. Arabidopsis thaliana contains two phosphoenolpyruvate carboxylase kinase genes with different expression patterns. Plant Cell & Environment (2002) 25:115–122.[Medline]
Frohnmeyer H, Staiger D. Ultraviolet-B radiation-mediated responses in plants: balancing damage and protection. Plant Physiol (2003) 133:1420–1428.
Gendrel AV, Lippman Z, Yordan C, Colot V, Martienssen RA. Dependence of heterochromatic histone H3 methylation patterns on the Arabidopsis gene DDM1. Science (2002) 297:1871–1873.
Hahlbrock K, Scheel D. Physiology and molecular-biology of phenylpropanoid metabolism. Ann. Rev. Plant Physiol. Plant Mol. Biol. (1989) 40:347–369.[CrossRef]
Izaguirre MM, Scopel AL, Baldwin IT, Ballaré CL. Convergent responses to stress: solar ultraviolet-B radiation and Manduca sexta herbivory elicit overlapping transcriptional responses in field-grown plants of Nicotiana longiflora. Plant Physiol (2003) 132:1755–1767.
Jansen MAK, Gaba V, Greenberg BM. Higher plants and UB-B radiation: balancing damage, repair and acclimation. Trends in Plant Sci. (1998) 3:131–135.[CrossRef]
Jenkins GI, Brown BA. UV-B perception and signal transduction. In: Light and Plant Development—Whitelam GC, Halliday KJ, eds. (2007) Oxford: Blackwell Publishing. 155–182.
Jenkins GI, Long JC, Wade HK, Shenton MR, Bibikova TN. UV and blue light signalling: pathways regulating chalcone synthase gene expression in Arabidopsis. New Phytol (2001) 151:121–131.[CrossRef][Web of Science]
Kaiserli E, Jenkins GI. UV-B promotes rapid nuclear translocation of the Arabidopsis UV-B-specific signaling component UVR8 and activates its function in the nucleus. Plant Cell (2007) 19:2662–2673.
Kim BC, Tennessen DJ, Last RL. UV-B-induced photomorphogenesis in Arabidopsis thaliana. Plant Journal (1998) 15:667–674.[CrossRef][Web of Science][Medline]
Kliebenstein DJ, Lim JE, Landry LG, Last RL. Arabidopsis UVR8 regulates ultraviolet-B signal transduction and tolerance and contains sequence similarity to human Regulator of Chromatin Condensation 1. Plant Physiol (2002) 130:234–243.
Kouzarides T. Chromatin modifications and their function. Cell (2007) 128:693–705.[CrossRef][Web of Science][Medline]
Lee J, He K, Stolc V, Lee H, Figueroa P, Gao Y, Tongprasit W, Zhao H, Lee I, Deng X-W. Analysis of transcription factor HY5 genomic binding sites revealed its hierarchical role in light regulation of development. Plant Cell (2007) 19:731–749.
Li B, Carey M, Workman JL. The role of chromatin in transcription. Cell (2007) 128:707–719.[CrossRef][Web of Science][Medline]
Li JY, Oulee TM, Raba R, Amundson RG, Last RL. Arabidopsis flavonoid mutants are hypersensitive to UV-B irradiation. Plant Cell (1993) 5:171–179.[Abstract]
Loidl P. A plant dialect of the histone language. Trends Plant Sci. (2004) 9:84–90.[CrossRef][Web of Science][Medline]
McKenzie RL, Bjorn LO, Bais A, Ilyasd M. Changes in biologically active ultraviolet radiation reaching the Earth's surface. Photochemical & Photobiological Sciences (2003) 2:5–15.[CrossRef][Web of Science][Medline]
Mehrtens F, Kranz H, Bednarek P, Weisshaar B. The Arabidopsis transcription factor MYB12 is a flavonol-specific regulator of phenylpropanoid biosynthesis. Plant Physiol (2005) 138:1083–1096.
Nemergut ME, Mizzen CA, Stukenberg T, Allis CD, Macara IG. Chromatin docking and exchange activity enhancement of RCC1 by histones H2A and H2B. Science (2001) 292:1540–1543.
Ng DW-K, Chandrasekharan MB, Hall TC. Ordered histone modifications are associated with transcriptional poising and activation of the phaseolin promoter. Plant Cell (2006) 18:119–132.
Oravecz A, Baumann A, Máté Z, Brzezinska A, Molinier J, Oakeley EJ, ÁdámÉ E, Schäfer E, Nagy F, Ulm R. CONSTITUTIVELY PHOTOMORPHOGENIC1 is required for the UV-B response in Arabidopsis. Plant Cell (2006) 18:1975–1990.
Paul ND, Gwynn-Jones D. Ecological roles of solar UV radiation: towards an integrated approach. Trends in Ecology & Evolution (2003) 18:48–55.[CrossRef][Web of Science]
Stapleton AE, Walbot V. Flavonoids can protect maize DNA from the induction of ultraviolet-radiation damage. Plant Physiol (1994) 105:881–889.[Abstract]
Tanny JC, Erdjument–Bromage H, Tempst P, Allis CD. Ubiquitylation of histone H2B controls RNA polymrase II transcription elongation independently of histone H3 methylation. Genes Dev. (2007) 21:835–847.
Ulm R, Nagy F. Signalling and gene regulation in response to ultraviolet light. Curr. Opinion Plant Biol. (2005) 8:477–482.[CrossRef][Web of Science][Medline]
Ulm R, Baumann A, Oravecz A, Mate Z, Adam E, Oakeley EJ, Schäfer E, Nagy F. Genome-wide analysis of gene expression reveals function of the bZIP transcription factor HY5 in the UV-B response of Arabidopsis. Proc. Natl Acad. Sci. USA (2004) 101:1397–1402.
Wade HK, Bibikova TN, Valentine WJ, Jenkins GI. Interactions within a network of phytochrome, cryptochrome and UV-B phototransduction pathways regulate chalcone synthase gene expression in Arabidopsis leaf tissue. Plant Journal (2001) 25:675–685.[CrossRef][Web of Science][Medline]
Weisshaar B, Jenkins GI. Phenylpropanoid biosynthesis and its regulation. Curr. Opinion Plant Biol. (1998) 1:251–257.[CrossRef][Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Tong, C. D. Leasure, X. Hou, G. Yuen, W. Briggs, and Z.-H. He Role of root UV-B sensing in Arabidopsis early seedling development PNAS, December 30, 2008; 105(52): 21039 - 21044. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||