Molecular Plant Advance Access originally published online on February 11, 2008
Molecular Plant 2008 1(2):285-294; doi:10.1093/mp/ssn002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Characterization of Gibberellin Receptor Mutants of Barley (Hordeum vulgare L.)
a CSIRO Plant Industry, GPO Box 1600, Canberra, ACT 2601, Australia
b Research School of Chemistry, Australian National University, Canberra, ACT 0200, Australia
1 To whom correspondence should be addressed. E-mail peter.chandler{at}csiro.au, fax 61 2 6246 5000, tel. 61 2 6246 5251.
| Abstract |
|---|
|
|
|---|
The sequence of Gid1 (a gene for a gibberellin (GA) receptor from rice) was used to identify a putative orthologue from barley. This was expressed in E. coli, and produced a protein that was able to bind GA in vitro with both structural specificity and saturability. Its potential role in GA responses was investigated using barley mutants with reduced GA sensitivity (gse1 mutants). Sixteen different gse1 mutants each carried a unique nucleotide substitution in this sequence. In all but one case, these changes resulted in single amino acid substitutions, and, for the remaining mutant, a substitution in the 5 untranslated region of the mRNA is proposed to interfere with translation initiation. There was perfect linkage in segregating populations between new mutant alleles and the gse1 phenotype, leading to the conclusion that the putative GID1 GA receptor sequence in barley corresponds to the Gse1 locus. Determination of endogenous GA contents in one of the mutants revealed enhanced accumulation of bioactive GA1, and a deficit of C20 GA precursors. All of the gse1 mutants had reduced sensitivity to exogenous GA3, and to AC94377 (a GA analogue) at concentrations that are normally saturating, but, at much higher concentrations, there was often a considerable response. The comparison between barley and rice mutants reveals interesting differences between these two cereal species in GA hormonal physiology.
| INTRODUCTION |
|---|
|
|
|---|
An understanding of how plants respond to gibberellin (GA) at the molecular level has proved elusive because of a lack of good candidate genes for the GA receptor. However, the recent report by Ueguchi-Tanaka et al. (2005) describing the map-based cloning of the GA-insensitive dwarf 1 (Gid1) locus in rice has now opened up new opportunities for experiments on GA perception. The GID1 protein is closely related to a family of enzymes with lipase/esterase activity, previously unsuspected of being involved in GA signaling. The observation that GID1 occurred predominantly in the nucleus suggests that intracellular GA may be responsible for initiating GA signaling. The phenotype of rice gid1 mutants indicated that the GID1 GA receptor was essential for two well characterized though distinct GA responses—leaf sheath growth, and
-amylase production by aleurone tissue. Yeast two-hybrid experiments indicated a GA-dependent interaction between GID1 and SLENDER1 (SLR1)—a protein known to be important in GA signaling. Rice Gid1 is a single gene, but a search of the Arabidopsis genome revealed three AtGID1 genes with considerable (67–85%) amino acid sequence similarity. Each of the AtGID1 genes was introduced into the rice gid1-1 mutant background, and shown to function as a GA receptor in planta based on restoring growth and the capacity to respond to GA (Nakajima et al., 2006). Expressed GID1 protein bound a GA4 derivative in vitro, but binding was not observed with mutant GID1 proteins having amino acid substitutions corresponding to rice gid1 mutant alleles. Based on competition binding studies, the Kd values for active GAs were estimated to be in the range 0.2–4 µM, and were considerably higher than those found for biologically inactive GAs (30 to >200 µM; Ueguchi-Tanaka et al., 2005). These estimated Kd values are higher than might be predicted for a functional GA receptor, given typical nanomolar concentrations of active GAs in vivo; however, the possible effect of SLR1 on GA-binding affinity by GID1 was not addressed in this early study. A thermodynamic box argument indicates that an enhanced interaction between GID1 and the DELLA protein SLR1 in the presence of GA means that GA will bind more tightly to the binary GID1:SLR1 complex by the same factor as the increase in GID1:SLR1 affinity in the presence of GA. Later studies have focused on GA binding by the three related AtGID1 proteins. GA4 (the principal active GA in Arabidopsis) had the highest binding efficiency, with IC50 values of 0.3 µM for AtGID1a and AtGID1c, but a 10-fold higher affinity (0.03 µM) was found for AtGID1b. Importantly, binding of the labeled GA4 derivative was about 100-fold higher in the presence of the AtDELLA proteins RGA or GAI, which are related to rice SLR1 (Nakajima et al., 2006), bringing the estimated Kd values into the range expected for GA perception in vivo. The same thermodynamic arguments mentioned above tell us that the affinity of AtGID1b for the AtDELLA proteins RGA or GAI increases by 100-fold in the presence of GA.
Nakajima et al. (2006) showed that each of the three AtGID1 proteins interacted with each of the five AtDELLA proteins. The DELLA domain of these proteins is important for the interaction with AtGID1, since mutants in this domain show either no or a weakened interaction (Griffiths et al., 2006; Willige et al., 2007). The interaction between DELLA proteins and GID1 is presumably a precursor to GA signal transduction, which has been associated with degradation of DELLA proteins by the SCF E3 ubiquitin ligase, involving the specific F-box proteins SLY1 in Arabidopsis (McGinnis et al., 2003) and GID2 in rice (Sasaki et al., 2003). Griffiths et al. (2006) demonstrated by a yeast three-hybrid assay that the GA-receptor complex enhanced the interaction between one of the AtDELLA proteins and the F-box protein SLY1. As explained above, it is possible that GA binds even more tightly to the ternary GID1:DELLA:F-box complex than to the smaller complexes.
Confirmation that the interactions observed between GID1 and SLR1 in yeast also occur in planta has been recently reported by Ueguchi-Tanaka et al. (2007). A combination of co-immunoprecipitation experiments and bimolecular fluorescence complementation assays demonstrated physical interactions between these proteins in the presence of GA4. The DELLA and TVHYNP domains of SLR1 were required for these interactions to occur. A comprehensive analysis of conserved regions in the GID1 protein sequence involved making 94 substitutions of GID1, where alanine replaced conserved amino acids. Twelve of these sites were identified as essential for GA-binding activity, and all of these were also required for SLR1 interaction, indicating that GA binding to GID1 is a precursor to interaction with SLR1.
Multiple receptors have now been characterized for the other major plant hormones, so it seems unlikely that there will be a single receptor for GA. Nevertheless, the properties of the rice gid1 mutants are consistent with such a possibility, at least for two well defined GA responses. If there are other GA receptors involved in these responses in rice, they must operate in concert with the GID1 GA receptor. In Arabidopsis, the loss of any one of the three AtGID1 genes results in no apparent phenotype, and only one of the three double-mutant combinations shows dwarfism, indicating a considerable degree of functional redundancy between the AtGID1 genes. The triple knockout mutant has lost the ability to respond to GA and is extremely dwarfed (Griffiths et al., 2006; Iuchi et al., 2007).
The GID1 GA receptor sequences from rice and Arabidopsis have allowed database searches for putative orthologues in other plant species. In barley, mutants were previously described which had reduced sensitivity (by 100- to 1000-fold) to exogenous GA3 for both leaf growth and aleurone responses. The properties of these GA sensitivity (Gse1) mutants were consistent with defects either in a GA receptor or in some early step of GA signaling, since they were hypostatic to elongated sln1 mutants (Chandler and Robertson, 1999). The sequence of the rice GID1 GA receptor allowed the former possibility to be tested. In this paper, we report that 16 different gse1 alleles in barley all show single nucleotide substitutions in a GID1-related sequence. We also show binding of expressed GSE1 [NCBI GEO] protein to GA in vitro, and compare the phenotypes of the corresponding barley and rice GID1 GA receptor mutants.
| RESULTS |
|---|
|
|
|---|
A Sequence in Barley Related to GID1 GA Receptor Sequences
A database search using the GID1 protein sequence from rice revealed translated barley EST sequences that potentially defined an orthologous protein. The 354-residue barley amino acid sequence had 83% identity with the rice GID1 sequence (Figure 1), and 59–62% identity with the AtGID1 sequences from Arabidopsis. Primers to this sequence were designed, and PCR products were amplified and sequenced, to confirm its presence in Himalaya barley DNA (data not shown). The GSE1 [NCBI GEO] amino acid sequence shared with GID1 and AtGID1 sequences two conserved residues (S199 and D297) that form part of the catalytic triad of related esterase proteins, as well as an oxyanion hole (G122, G123, and S200). As is the case with the GA receptors from rice and Arabidopsis, the final histidine residue of the catalytic triad is replaced by an aliphatic amino acid (I327 for GSE1 [NCBI GEO] ). Putative GID1 orthologues from diverse plant species were identified in sequence databases and are included in a phylogenetic tree (Figure 2). To illustrate the discrete nature of the GID1 GA receptor family, the tree also includes the next five most closely related proteins from the sequenced genomes of Arabidopsis and rice. All of the putative GID1 orthologues from angiosperms and gymnosperms cluster more closely to GID1 than to any of the next closest proteins in either the rice or Arabidopsis genomes. These newly identified putative orthologues also retain the first two residues of the conserved catalytic triad, and the oxyanion hole, but lack the final histidine.
|
|
|
Nucleotide Sequences of Barley gse1 Mutants
Portions of the derived mRNA were amplified from barley gse1 mutants and the products were sequenced. Fifteen mutants had unique, single nucleotide substitutions in the coding region. Most (10/15) of these were caused by G to A transitions, but 5/15 were C to T transitions. In every case, there was a corresponding missense mutation introduced into the deduced amino acid sequence (Table 1). The positions of amino acid substitutions in the gid1 mutants are shown in Figure 1. Some of these substitutions are conservative, for instance A46V, yet this allele (gse1h) results in moderate to severe dwarfism. In most cases, the amino acid substitutions in the gse1 mutants are in regions that are very highly or absolutely conserved in both the GA receptor cluster and the related esterase cluster shown in Figure 2. Other substitutions are in positions that are absolutely conserved in the receptor cluster but which are more variable in the esterase cluster.
The protein coding region of one gse1 mutant (gse1l) was identical to WT, so 5 and 3 untranslated (UT) regions were amplified and the products sequenced. One single transition (G to A) was detected in the 5 untranslated region (position 89 in EMBL/Genbank Accession AM849822 [GenBank] ), 200 nucleotides proximal to the AUG translation initiation codon. The secondary structure of this region was analyzed using PlotFold Graphic (GCG). The 5 region of the WT sequence was predicted to form a single prominent hairpin structure, approximately 140–150 nucleotide pairs in length, encompassing bases 25–317 and with the turn of the hairpin being at approx 164. The G to A substitution occurs about half-way along the stem, proximal to the turn, and the AUG translation initiation codon is located near the base of the stem, distal to the turn. PlotFold predicts a difference in free energy between the WT and gse1l mutant mRNA structures of about 5 kcal/mol, with the single nucleotide substitution destabilizing the hairpin structure in the mutant. This may be sufficient to impair translation initiation at the AUG codon, resulting in lower than normal amounts of the protein being synthesized. The potential for regulatory motifs in the 5 UT region is consistent with the unusually long length of this region for both rice and Arabidopsis GID1 receptor sequences (490 and a mean of 220 nucleotides, respectively), whereas those of the closely related esterase sequences are much shorter, from 21 to 80 nucleotides in length.
Segregation Studies
A cross between M488 (gse1a) and Morex barley yielded tall F1 plants, and an F2 population that included tall and dwarf seedlings in a 3:1 ratio (data not shown). Homozygous tall and homozygous dwarf F2 plants were identified by phenotyping of F3 progeny. DNA preparations from 11 homozygous tall F2 plants and 11 homozygous dwarf F2 plants allowed their genotype to be determined by sequencing the appropriate PCR products. The 11 tall plants all showed only a G peak at position 981 in the sequence, whereas the 11 dwarf plants showed only an A peak at this position. This G to A mutation therefore shows perfect segregation with phenotype. Less systematically, we have investigated the presence of a range of the other mutant alleles (Table 1) during back-crossing of the mutant lines to the parent Himalaya. In every case, we have observed the expected associations between genotype and phenotype.
We conclude that the rice GID1-related sequence from barley corresponds to the previously described Gse1 locus, based on (i) single, but distinct, nucleotide substitutions in 16 gse1 mutants previously identified through genetic complementation studies, (ii) corresponding predicted changes in the deduced amino acid sequence of 15 of these mutants, and a plausible explanation for why the 16th mutant might be expected to have a lower than normal amount of functional protein, and (iii) segregation studies that indicate complete linkage between genotype and phenotype. The allelic designations of the mutant lines are shown in Table 1.
Expression of GSE1 Protein and Binding of GA
Bacterially expressed GSE1
[NCBI GEO]
protein was able to bind [14C]-GA1, as revealed by the elution of radioactivity in the excluded fractions (7–9) of a gel filtration column (Figure 3). A range of controls indicate that this binding is specific for the presence of GSE1
[NCBI GEO]
(absent with [14C]-GA1 alone), for GA structure (no binding of [14C]-GA20, an inactive precursor to GA1), for protein structure (absent with ovalbumin), and is saturable (absent with a 100-fold excess of [12C]-GA1). Similar binding has been observed to [14C]-GA3 (data not shown).
|
Growth Responses of gse1 Mutants to GA3
The first gse1 mutants were initially characterized by GA dose–response curves. They required much higher (100- to 1000-fold) concentrations of applied GA3 to stimulate leaf elongation rate than were required by either the WT or by similarly dwarfed GA-deficient mutants (Chandler and Robertson, 1999).
The maximal daily elongation rate (LERmax) of the first leaf of germinated grains is a useful measure of GA response (Chandler and Robertson, 1999). LERmax values for a GA biosynthetic dwarf mutant (grd2b), and for the 16 different gse1 mutants were determined for grains germinated in control solution (no GA3), or in GA3 solution at either 10 µM or 1 mM. The results (Figure 4A) reveal considerable variation in LERmax values between different gse1 mutants in control conditions, which relates closely to their degree of dwarfing during plant growth; for instance, the gse1j and gse1k alleles are the most dwarfed lines, whereas gse1l and gse1n are the least dwarfed (data not shown). There are large and statistically significant differences between alleles in the growth rate increment resulting from a very high concentration of exogenous GA3 (1 mM). Note that there does not seem to be any correlation between the degree of dwarfing on control medium, and the extent of GA response. In fact, three alleles (gse1l, gse1m, gse1n) which are relatively tall on control medium have smaller responses to 1 mM GA3 than found for the other alleles.
|
The data in Figure 4B partition, for each mutant allele, the observed growth increment (over control values) to 1 mM GA3 into two concentration windows: 0–0.01 mM, and 0.01–1 mM. For a GA biosynthetic mutant, such as grd2b, about 90% of the increment has already occurred at a GA3 concentration of 0.01 mM. A further 100-fold increase in [GA3] to 1 mM gave only a small increase in growth rate. By comparison, all of the gse1 mutants showed much less of a growth response to typical saturating concentrations of GA3 (0.001–0.01 mM), and they showed a greater percentage of their growth response occurring in the higher concentration range. In some cases, this is very marked; for instance, gse1a, gse1f, gse1k, and gse1o mutants all have at least 50% of the growth increment occurring in the higher concentration range. Limited studies using even higher concentrations of GA3 have shown that two of these mutants (gse1k and gse1o) showed further substantial and statistically significant increases in growth rate as the GA3 concentration increased from 1 to 10 mM (data not shown). For this group of four mutants, we are almost certainly underestimating the proportion of the growth response which will occur at high concentrations, simply because we are failing to reach saturation of the response. Interestingly, the gse1m mutant did not show any additional growth response to 10 mM GA3. This mutant is a representative of the group of three (gse1l, gse1m, gse1n) that shows a relatively small growth response to GA3 (Figure 4A), most of which occurs in the lower concentration window (Figure 4B). This suggests that their lack of a larger growth response is probably not due to failure to achieve saturating concentrations of GA3. The limited availability of GA3 of sufficient purity (crystallized) that is necessary for working with such high concentrations (see Chandler and Robertson, 1999) has prevented us from examining the growth response of all alleles.
Endosperm Half-Grain Responses of gse1 Mutants to GA3
Aleurone tissue from Himalaya barley produces
-amylase in the presence of bioactive GAs. Previously, we examined production of
-amylase by the gse1a mutant (Chandler and Robertson, 1999). There was much less
-amylase produced by the mutant at low concentrations of GA3, but, at high concentrations, there was almost as much as WT. The behaviour of endosperm half-grains of four new gse1 alleles, representing some of the different allelic groupings identified in the growth assays above, was compared to WT over a range of GA3 concentrations (Figure 5).
|
The WT, as expected, produced very little
-amylase in the absence of GA3, but had produced large amounts of
-amylase after 3 d incubation in 10–100 nM GA3. There was only a relatively small increase in
-amylase production as the concentration of exogenous GA3 rose a further 104-fold. All of the gse1 mutants required higher concentrations of GA3 than the WT to produce equivalent amounts of
-amylase, but there appeared to be no major differences between the alleles in dose–response characters, despite the differences they show in leaf growth responses (Figure 4). Even at the highest concentrations tested, they did not produce as much as the WT, but a possible contributing factor is the smaller size of gse1 grains. Potentially, this might mean a smaller number of aleurone cells per grain and a reduced capacity for
-amylase production.
Growth Response of gse1 Mutants to AC94377
AC94377 is an N-substituted phthalimide that has growth promoting activity (Rodaway et al., 1991). At low concentrations, it stimulates growth of a GA-deficient mutant almost as well as GA3, and it fails to stimulate growth of a GA signaling mutant Sln1d, as previously reported for Rht wheat lines (data not shown; Rodaway et al., 1991). These results suggest that the compound has gibberellin-like activity, despite the lack of structural similarity between AC94377 and GAs.
The growth response of gse1 mutants to AC94377 was assessed relative to their response to an equivalent concentration of GA3. In preliminary experiments, there was either very little or no growth stimulation of gse1 mutants at low concentrations (50 µM) of AC94377, although this concentration gave substantial growth stimulation of GA-deficient mutants (data not shown). At very high concentrations of AC94377 (>1 mM), we observed growth inhibition, possibly due to impurities in the preparation. The experiment was repeated using the highest concentration (500 µM) of AC94377 that still maintained growth-promoting activity. By doing so, we aimed to maximize the possibility of observing a growth response to AC94377, allowing us to compare the magnitude of this growth response to that caused by 500 µM GA3—a high (though not saturating, see above) dose for gse1 mutants.
There was considerable variation between alleles in their response to AC94377, when expressed as a percentage of their response to GA3 (relative response; Table 2). As expected, two different GA-deficiency loci showed a large response to AC94377, with the relative response being 81–83%. Hence, at this concentration, AC94377 is almost as efficient as GA3 in stimulating growth of GA-deficient dwarf mutants. Some of the gse1 mutants had very small growth responses to AC94377, the two most extreme being gse1a and gse1c, each having only 8% of the response to GA3. Other mutants had about 40% of the response to GA3, for instance gse1p (41%) and both gse1d and gse1m (38%). The mutant in the 5 untranslated region (gse1l) had the highest relative response (48%). In all cases, mutants that were selected initially on the basis of dwarfism, and that we show here to have mutations in the GA receptor, are also affected in their response to AC94377, although the extent differs among alleles.
|
These data suggest that AC94377 activates GA signaling via the GA receptor, but they do not indicate whether it binds to the same site on the receptor as active GAs. The variable response ratio observed (Table 1) could be taken as support for independent binding sites, but the differences in structure between these compounds might also result in different binding efficiencies to mutant receptors, even if the compounds bind to the same site.
Contents of Endogenous GAs in gse1 Mutants
The GA contents of the original gse1 mutant (M488, gse1a) have been compared with those of the WT in the growing blade of the third leaf. The GA composition along the growing leaf blade is non-uniform, so it is necessary to compare leaf sections that are equivalent in terms of development and growth. The results (Table 3) indicate an approximate four-fold increase in the content of active GA (GA1) in both the elongation zone (EZ) and the next distal segment along the blade, and an even larger increase in the content of GA34. Surprisingly, there was no increase in the content of GA8. GA4 could not be determined in these experiments because of interfering ions. There were also large reductions in the contents of the C20-GA precursors GA53, GA44 and GA19.
|
| DISCUSSION |
|---|
|
|
|---|
Phenotypes of Barley Mutants Compared to Rice Mutants
The barley GA receptor (Gse1) mutants are similar to those described in rice, but differ in a number of respects. Of eight rice gid1 mutants, six are severe dwarfs, one is a moderate dwarf, and one a mild dwarf; only the latter produces fertile flowers and seed (Ueguchi-Tanaka et al., 2007). The 16 different gse1 mutants described here range from severe to mild dwarfs, and all can be maintained as homozygous lines, although the more severe dwarfs show reduced grain set and are better maintained as heterozygotes. The elongated SLR1 mutant of rice was epistatic to the gid1-1 mutant, consistent with the earlier report that the elongated sln1c mutant in barley is epistatic to gse1a (Chandler and Robertson, 1999). Both results support the view that loss of function alleles of Sln1 act downstream of the GA receptor.
The most obvious phenotype of the rice mutants is the lack of any response to GA3 in terms of either growth (length of second leaf sheath) or
-amylase production by half-grains, even up to relatively high concentrations of exogenous GA3 (100 and 10 µM, respectively; Ueguchi-Tanaka et al., 2005). Each of the barley mutants also showed reduced sensitivity to GA3 in growth assays (LERmax), but, at very high concentrations of exogenous GA3, some alleles gave a large growth response. When a representative selection of alleles was tested for
-amylase production, the half-grains showed very little response at low concentrations of GA3, but considerable production at high concentrations. The previously characterized Sln1d mutant in barley showed a very similar response of half-grains, but shows very little growth response to high concentrations of GA3 (Chandler et al., 2002). Therefore, when compared to rice, the distinguishing feature of the barley mutants is their responsiveness to GA3 at high concentrations in both assays.
There may also be a difference between the rice and barley mutants in the effect of GA receptor mutations on the contents of endogenous GAs. When the hormone contents of whole shoots of 1-month-old WT rice plants were compared to those of severely dwarfed gid1 mutants, there was a very large (95- to 125-fold) increase in the content of endogenous GA1 (the principal bioactive GA for vegetative growth). The contents of C20-GA precursors (GA53, GA44, GA19) showed very little change, which is surprising given the increase reported in the amount of GA20ox2 transcript (Ueguchi-Tanaka et al., 2005). Although the barley results are not directly comparable to the rice assays, they showed a different pattern. There was a modest (about four-fold) increase in GA1 content, six- to 12-fold reductions in the contents of C20-GA precursors, and a seven-fold increase in the content of GA34 (a catabolite of GA4), but not of GA8 (the corresponding catabolite of GA1). The overall changes in this GA receptor mutant were very similar to those seen previously for the Sln1d mutant (Chandler et al., 2002). The variation in hormone content, even within a single leaf (compare GA contents for EZ and next segments in Table 3), means that it is difficult to make reliable comparisons between plants that differ greatly in development stage and extent of growth. In Arabidopsis, the triple knockout GA receptor mutant showed a 16-fold increase in GA4 content, and a 26-fold increase in GA34, but there were no data reported for the C20-GA precursors (Griffiths et al., 2006).
Initial Events in GA Signal Transduction
Are there other GA signaling mechanisms that do not involve the GID1-type GA receptor? Earlier studies had suggested the possibility of a membrane-associated GA receptor in aleurone protoplasts of wild oat (Avena fatua L.) and of Himalaya barley (Hooley et al., 1991; Gilroy and Jones, 1994) that detected GA outside of the cell and which would clearly be different from the GID1 class of receptor. However, the observation that a large number of rice and barley gid1/gse1 mutants show alterations in their aleurone response to GA3 argues strongly for the involvement of the GID1 receptor in the aleurone response. Whether this receptor is wholly responsible for the aleurone response, or whether it acts in concert with other GA sensing molecules, remains an open question. Recent studies on ABA receptors in plants have already led to the characterization of three different receptors (Razem et al., 2006; Shen et al., 2006; Liu et al., 2007). The possibility of GA receptors on aleurone cells that detect extracellular GA remains open, and it would be of interest to know whether rice aleurone protoplasts would respond to impermeant GA in the same manner as oat and barley (Hooley et al., 1991; Gilroy and Jones, 1994).
In barley, unlike rice, there is evidence for a second GA signaling mechanism that can stimulate both growth and aleurone responses at high concentrations of exogenous GA3 in all gse1 mutants examined. It is difficult to judge the significance of this mechanism, since it only occurs at concentrations that are likely to far exceed any concentration of bioactive GA achieved in planta. Under such conditions, there may be breakdown in some of the normal mechanisms that confer specificity on GA responses in vivo. One possibility is that all 16 barley alleles retain a small amount of GSE1 [NCBI GEO] receptor activity, sufficient to elicit GA responses at high GA concentrations, since each mutant allele described here involves a missense mutation (with the exception of the putative 5 untranslated region mutant). Mutants with a complete loss of GSE1 [NCBI GEO] function may not grow, and so would not be recovered in a mutant screen. But there are arguments against this possibility. First, with a large number of alleles, we might expect some mutants to show complete insensitivity to exogenous GA3, as found for three out of the four missense mutants in rice (gid1-1, gid1-2, gid1-5; Ueguchi-Tanaka et al., 2005, 2007). Second, there is no clear correlation between the severity of dwarfing caused by an allele and the degree of residual GA response it shows; there are severe dwarfs that show a large GA response, and mild dwarfs that show relatively little GA response. These observations suggest that the different gse1 alleles are not simply regulating the volume of the response output.
It is of interest to determine whether the gse1 mutant alleles affect GA binding or the presumed interaction between GSE1 [NCBI GEO] and SLN1 (or whether both processes are affected). An X-ray crystal structure (1QZ3) for esterase 2 from Alicyclobacillus acidocaldarius (De Simone et al., 2004) that is related to GSE1 [NCBI GEO] has allowed us to map GSE1 [NCBI GEO] mutant alleles; many of them are in the vicinity of the substrate-binding cleft of the esterase, although there are some that are relatively distant (data not shown). We do not know at present whether GAs bind to this substrate binding cleft, although the recent study by Ueguchi-Tanaka et al. (2007) also used modelling to show that regions of rice GID1 that were identified as important for GA binding were frequently localized to the substrate-binding cleft. There are now exciting advances for understanding how allele specificity might relate to defects in either GA binding or SLN1 interaction.
| METHODS |
|---|
|
|
|---|
Chemicals
Crystalline GA3 was dissolved at high concentrations, as described previously (Chandler and Robertson, 1999). AC94377, 33.8 g per litre, was from American Cyanamid Company, Agricultural Research Division, Princeton, NJ, USA.
Identification of gse1 Mutants
The mutagenesis of Himalaya barley with sodium azide and the screening for dwarf mutants with different responses to exogenous GA3 have been described previously (Zwar and Chandler, 1995; Chandler and Robertson, 1999). Inter-crossing of mutants that showed a partial response to GA3 at high concentrations revealed 35 mutant lines in the Gse1 locus. Sequence analysis of these lines revealed that 16 independent mutations were represented, indicating that some of the mutants were siblings. Table 1 summarizes the stocks used, their allele designation, and the nucleotide and amino acid substitutions. Some of these lines have been through three back-crossing generations, and most of the remainder through two.
Seedling Growth and LERmax Determinations
The methods have been described previously (Chandler and Robertson, 1999).
Endosperm Half-Grain Assays and GA Determinations
The methods have been described previously (Chandler et al., 2002), except that hormone contents were determined on the 50% elongated blade of the third leaf, rather than on the second leaf.
Gse1 Sequence Analysis
Primers were designed to amplify DNA prepared from seedling leaves using the HotStarTaq DNA polymerase kit (Qiagen) according to the manufacturer's instructions. Three different amplifications covered the entire Gse1 sequence: 5 region: ACAACTCGCCTCACCAGC (fwd) and AAACGCAAGGACGGACAC (rev); central region TGGTTTGGTTTTTGGTTTGG (fwd) and TGGTAGTGGTCGGTGTTGG (rev); and 3 region GCTCAACGCCATGTTCG (fwd) and CAGCAGCAGCAGAGATGAAG (rev). Annealing was at 58°C, and extension at 72°C for 36 cycles. Aliquots of the products were analysed by gel electrophoresis to confirm size, purity, and template dependence of the reaction. Products were purified using the QIAquick PCR purification Kit (Qiagen) and aliquots taken for DNA sequencing. All mutations were confirmed in independent amplifications.
Production of GSE1 in Escherichia coli
The phage T7 promoter vector pETMCSI was as described (Neylon et al., 2000). A codon-optimized synthetic GSE1 gene with an NdeI site at the start codon and with the TAA stop codon followed by an EcoRI site in a plasmid pJ2:G01916 was obtained from DNA 2.0 Inc., Menlo Park, CA, USA. The GSE1 gene was excised from this plasmid as an
1-kb fragment by digestion with NdeI and EcoRI, and inserted between the same sites in pETMCSI to give the expression plasmid pMM1311. E. coli strain BL21(DE3)/pLysS (Studier et al., 1990) containing pMM1311 was grown for 48 h at room temperature in a ZY autoinduction medium (1 l) containing 50 mg l–1 ampicillin, 33 mg l–1 chloramphenicol, 0.5% glycerol, 0.05% glucose, and 0.1%
-lactose, as described (Studier, 2005); cells (typically 8–10 g wet weight) were harvested by centrifugation and stored frozen at –80°C. As required, portions (2 g) were thawed and re-suspended in 30 ml of ice-cold lysis buffer (50 mM Tris pH 7.6, containing 0.1 M NaCl, 1 mM EDTA, 1 mM dithiothreitol, and 10% w/v sucrose), and lysed by passage through a French press at 8000 psi. GSE1
[NCBI GEO]
was found to be in the pellet following centrifugation (35 000 g). The pellet was washed three times by re-suspension and centrifugation with 30 ml of 1 M NaCl in lysis buffer, then dissolved in 30 ml of 6 M guanidinium chloride in buffer A (50 mM Tris pH 7.5, containing 0.5 M NaCl, 1 mM EDTA, 1 mM dithiothreitol and 20% w/v glycerol). The sample was dialyzed against two changes of 2 l of buffer A and precipitated proteins were removed by centrifugation (30 000 g). The soluble fraction contained GSE1
[NCBI GEO]
that was approximately 80–90% pure, as assessed by SDS-PAGE.
GA-Binding Assays
Each binding reaction utilized 50 µg of the GSE1
[NCBI GEO]
protein preparation (or ovalbumin, as indicated) and 5K dpm [14C]-GA (GA1 or GA20, as indicated, approximately 34 µCi µmol–1) in 100 µl 0.1 M NaCl, 20 mM Tris pH 7.5, 5 mM dithiothreitol. After incubation at 22°C for 1 h, the mixture was applied to the top of a Sephadex G-25 (medium) gel filtration column (8 mm diameter x 70 mm height) pre-equilibrated at 4°C in 0.1 M NaCl, 20 mM Tris pH 7.5, 7% (v/v) glycerol. Fractions of 350 µl were collected and radioactivity determined by liquid scintillation counting. Calibration of the column with blue dextran indicated that excluded material appeared in fractions 7–9.
Accession Numbers
Sequence data from this article can be found in the EMBL/GenBank data libraries under accession number AM849822.
No conflict of interest declared.
-
Chandler PM, Robertson M. Gibberellin dose–response curves and the characterization of dwarf mutants of barley. Plant Physiol (1999) 120:623–632.
Chandler PM, Marion-Poll A, Ellis M, Gubler F. Mutants at the Slender1 locus of barley cv Himalaya. Molecular and physiological characterization. Plant Physiol (2002) 129:181–190.
De Simone G, Mandrich L, Menchise V, Giordano V, Febbraio F, Rossi M, Pedone C, Manco G. A substrate-induced switch in the reaction mechanism of a thermophilic esterase: kinetic evidences and structural basis. J. Biol. Chem. (2004) 279:6815–6823.
Gilroy S, Jones RL. Perception of gibberellin and abscisic acid at the external face of the plasma membrane of barley (Hordeum vulgare L.) aleurone protoplasts. Plant Physiol. (1994) 104:1185–1192.[Abstract]
Griffiths J, et al. Genetic characterization and functional analysis of the GID1 gibberellin receptors in Arabidopsis. Plant Cell (2006) 18:3399–3414.
Hooley R, Beale MH, Smith SJ. Gibberellin perception at the plasma membrane of Avena fatua aleurone protoplasts. Planta (1991) 183:274–280.[Web of Science]
Iuchi S, et al. Multiple loss-of-function of Arabidopsis gibberellin receptor AtGID1s completely shuts down a gibberellin signal. Plant J (2007) 50:958–966.[CrossRef][Web of Science][Medline]
Liu X, Yue Y, Li B, Nie Y, Li W, Wu W-H, Ma L. A G protein-coupled receptor is a plasma membrane receptor for the plant hormone abscisic acid. Science (2007) 315:1712–1716.
McGinnis KM, Thomas SG, Soule JD, Strader LC, Zale JM, Sun TP, Steber CM. The Arabidopsis SLEEPY1 gene encodes a putative F-box subunit of an SCF E3 ubiquitin ligase. Plant Cell (2003) 15:1120–1130.
Nakajima M, et al. Identification and characterization of Arabidopsis gibberellin receptors. Plant J (2006) 46:880–889.[CrossRef][Web of Science][Medline]
Neylon C, Brown SE, Kralicek AV, Miles CS, Love CA, Dixon NE. Interaction of the Escherichia coli replication terminator protein (Tus) with DNA: a model derived from DNA-binding studies of mutant proteins by surface plasmon resonance. Biochemistry (2000) 39:11989–11999.[CrossRef][Web of Science][Medline]
Razem FA, El-Kereamy A, Abrams SR, Hill RD. The RNA-binding protein FCA is an abscisic acid receptor. Nature (2006) 439:290–294.[CrossRef][Medline]
Rodaway SJ, Gates DW, Brindle C. Control of early seedling growth in varietal lines of hexaploid wheat (Triticum aestivum), durum wheat (Triticum durum), and barley (Hordeum vulgare) in response to the phthalimide growth regulant AC 94,377. Plant Growth Regul (1991) 10:243–259.[CrossRef][Web of Science]
Sasaki A, Itoh H, Gomi K, Ueguchi-Tanaka M, Ishiyama K, Kobayashi M, Jeong D-H, An G, Kitano H, Ashikari M, Matsuoka M. Accumulation of phosphorylated repressor for gibberellin signalling in an F-box mutant. Science (2003) 299:1896–1898.
Shen Y-Y, et al. The Mg-chelatase H subunit is an abscisic acid receptor. Nature (2006) 443:823–826.[CrossRef][Web of Science][Medline]
Studier FW. Protein production by auto-induction in high-density shaking cultures. Protein Expr. Purif (2005) 41:207–234.[CrossRef]
Studier FW, Rosenberg AH, Dunn JJ, Dubendorff JW. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol (1990) 185:60–89.[Medline]
Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution (2007) 24:1596–1599.
Ueguchi-Tanaka M, et al. GIBBERELLIN INSENSITIVE DWARF1 encodes a soluble receptor for gibberellin. Nature (2005) 437:693–698.[CrossRef][Medline]
Ueguchi-Tanaka M, et al. Molecular interactions of a soluble gibberellin receptor, GID1, with a rice DELLA protein, SLR1, and gibberellin. Plant Cell (2007) 19:2140–2155.
Willige BC, Ghosh S, Nill C, Zourelidou M, Dohmann EMN, Maier A, Schwechheimer C. The DELLA domain of GA INSENSITIVE mediates the interaction with the GA INSENSITIVE DWARF1A gibberellin receptor of Arabidopsis. Plant Cell (2007) 19:1209–1220.
Zwar JA, Chandler PM.
-Amylase production and leaf protein synthesis in a gibberellin-responsive dwarf mutant of Himalaya barley (Hordeum vulgare L.). Planta (1995) 197:39–48.[Web of Science]
This article has been cited by other articles:
![]() |
D. Lewis, A. Bacic, P. M. Chandler, and E. J. Newbigin Aberrant Cell Expansion in the elongation Mutants of Barley Plant Cell Physiol., March 1, 2009; 50(3): 554 - 571. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||





