Skip Navigation



Molecular Plant Advance Access published online on April 22, 2008

Molecular Plant, doi:10.1093/mp/ssn017
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
1/3/552    most recent
ssn017v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chern, M.
Right arrow Articles by Ronald, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press on behalf of CSPP and IPPE, SIBS, CAS.

Strong Suppression of Systemic Acquired Resistance in Arabidopsis by NRR is Dependent on its Ability to Interact with NPR1and its Putative Repression Domain

Mawsheng Chern, Patrick E. Canlas and Pamela C. Ronald1

Department of Plant Pathology, University of California, Davis, CA 95616, USA

1 To whom correspondence should be addressed. E-mail pcronald{at}ucdavis.edu, fax +1 530 752 5674.


    Abstract
 TOP
 Abstract
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 FUNDING
 
Systemic Acquired Resistance (SAR) in plants confers lasting broad-spectrum resistance to pathogens and requires the phytohormone salicylic acid (SA). Arabidopsis NPR1/NIM1 is a key regulator of the SAR response. Studies attempting to reveal the function of NPR1 and how it mediates SA signaling have led to isolation of two classes of proteins that interact with NPR1: the first class includes rice NRR, Arabidopsis NIMIN1, NIMIN2, and NIMIN3, and tobacco NIMIN2-like proteins; the second class belongs to TGA transcription factors. We have previously shown that overexpression of NRR in rice suppresses both basal and Xa21-mediated resistance. In order to test whether NRR affects SA-induced, NPR1-mediated SAR, we have transformed Arabidopsis with the rice NRR gene and tested its effects on the defense response. Expression of NRR in Arabidopsis results in suppression of PR gene induction by SAR inducer and resistance to pathogens. These phenotypes are even more severe than those of the npr1-1 mutant. The ability of NRR to suppress PR gene induction and disease resistance is correlated with its ability to bind to NPR1 because two point mutations in NRR, which reduce NPR1 binding, fail to suppress NPR1. In contrast, wild-type and a mutant NRR, which still binds to NPR1 strongly, retain the ability to suppress the SAR response. Replacing the C-terminal 79 amino acids of NRR with the VP16 activation domain turns the fusion protein into a transcriptional co-activator. These results indicate that NRR binds to NPR1 in vivo in a protein complex to inhibit transcriptional activation of PR genes and that NRR contains a transcription repression domain for active repression.

Key Words: NRR • NPR1 • SA • SAR • disease resistance


    INTRODUCTION
 TOP
 Abstract
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 FUNDING
 
Systemic acquired resistance (SAR) is an induced defense response in plants; it induces expression of pathogenesis-related (PR) genes (Ryals et al., 1996) and confers lasting broad-spectrum resistance to viral, bacterial, and fungal pathogens. In dicots, such as Arabidopsis and tobacco, the phytohormone salicylic acid (SA) and the synthetic chemicals 2,6-dichloroisonicotinic acid (INA) and benzothiadiazole (BTH) are potent inducers of SAR (Friedrich et al., 1996). The NPR1 (for non-expresser of PR genes 1; also known as NIM1 and SAI1) gene is identified as a key regulator of the SA-mediated SAR pathway in Arabidopsis (Cao et al., 1994; Delaney et al., 1995; Glazebrook et al., 1996; Shah et al., 1997). NPR1 expression levels become elevated upon induction by SA, INA, BTH, or pathogen infection (Cao et al., 1997; Ryals et al., 1997). Arabidopsis npr1/nim1 mutants are impaired in their ability to induce PR gene expression and mount a SAR response, even after treatment with SA or INA.

Intensive investigations have shed some light on how NPR1 mediates SAR. NPR1 contains a bipartite nuclear localization sequence and two potential protein–protein interaction domains: an ankyrin repeat domain and a BTB/POZ domain (Cao et al., 1997; Ryals et al., 1997). NPR1 functions as a transcriptional co-activator in a TGA2–NPR1 complex after SA treatment in an in-vivo transient cell assay; this function requires the BTB/POZ domain and the oxidation of NPR1 Cys-521 and Cys-529 (Rochon et al., 2006). Nuclear localization of NPR1 protein is essential for its function (Kinkema et al., 2000). Without induction, NPR1 protein forms an oligomer and is excluded from the nucleus. Redox changes mediate SAR induction, causing monomeric NPR1 to emerge and accumulate in the nucleus and activate PR gene expression (Mou et al. 2003).

In search of proteins that mediate NPR1 function, several groups have identified TGA family members of basic-region leucine zipper (bZIP) transcription factors, both from Arabidopsis (Zhang et al., 1999; Despres et al., 2000; Zhou et al., 2000) and from rice (Chern et al., 2001), as NPR1 interacting proteins. The ankyrin repeats of NPR1 are necessary and sufficient for the interaction with TGA proteins but the interaction can be abolished by npr1-1 and npr1-2 mutants (Zhang et al., 1999). The interaction between NPR1 and TGA proteins facilitates in-vitro binding of the TGA proteins (Despres et al., 2000) and recruits them in vivo (Johnson et al., 2003) to the SA-responsive promoters. In-vivo interaction between NPR1 and a GAL4:TGA2 fusion (GAL4 DNA-binding domain fused to TGA2) protein leads to SA-mediated gene activation in Arabidopsis (Fan and Dong, 2002), supporting the notion that NPR1 binds in vivo to TGA2, which mediates transcriptional activation of downstream genes. The Arabidopsis triple knockout mutant tga2tga5tga6 blocks induction of PR gene expression and pathogen resistance (Zhang et al., 2003), further supporting the hypothesis that TGA proteins mediate NPR1 function. TGA2, TGA5, and TGA6 function redundantly as negative regulators of PR genes before induction (Zhang et al., 2003; Rochon et al., 2006). It is thought that, after induction, TGA proteins serve to anchor NPR1 to PR gene promoters to activate the genes.

In Arabidopsis, another group of NIM1/NPR1 interacting proteins were identified and named NIMIN1, NIMIN2, and NIMIN3. These three Arabidopsis proteins share very limited sequence similarity but may be structurally related (Weigel et al., 2001). In tobacco, three NIMIN2-like (NIMIN2a, 2b, and 2c) were identified as NPR1 interactors (Zwicker et al., 2007). Weigel et al. (2005) further showed that overexpression of NIMIN1 in Arabidopsis led to abolishment of the SAR response after SA treatment and that knockout and RNA-silencing of NIMIN1 resulted in enhanced PR-1 gene expression after SA treatment, but no clear effects on disease resistance. In tobacco, Zwicker et al. (2007) showed that constitutive expression of NtNIMIN2a led to delayed PR-1 induction and suppression of NIMIN2 transcripts enhanced the accumulation of PR-1 protein.

In Arabidopsis, overexpression of NPR1 leads to enhanced disease resistance to both bacterial and oomycete pathogens (Cao et al., 1998; Friedrich et al., 2001). In rice, overexpression of Arabidopsis NPR1 (Chern et al., 2001) or the rice homologue NH1 (Chern et al., 2005b) results in enhanced resistance to the pathogen Xanthomonas oryzae pv. oryzae (Xoo), strongly suggesting the presence of a related defense pathway in rice.

We have previously reported the isolation and characterization of a novel rice gene NRR (for Negative Regulator of disease Resistance) (Chern et al., 2005a). Overexpression of NRR in rice leads to super-susceptibility to Xoo, impairing both basal and Xa21-mediated resistance. NRR interacts with both the Arabidopsis NPR1 protein and the rice NH1 protein. NRR shows limited similarity to the Arabidopsis and tobacco NIMIN2 proteins, only in the NPR1 interaction domain and a short EAR (ERF-associated amphiphilic repression; Ohta et al., 2001) motif-like sequence (LDLNxxP) near the C-terminus. Although function of tobacco NIMIN2a have been studied in transgenic tobacco, the roles of the Arabidopsis NIMIN2 and rice NRR in SAR have not been demonstrated. To probe the function of NRR, we transformed Arabidopsis with the NRR gene and tested effects on the SA-induced, NPR1-mediated SAR response. Here, we report striking suppression of the SAR response in Arabidopsis by rice NRR. These effects appear to be dependent on the ability of NRR to interact with NPR1 and its C-terminal half, containing the putative repression motif. Swapping the C-terminus of NRR with a VP16 transcription activation domain turns the protein into a transcriptional co-activator.


    RESULTS
 TOP
 Abstract
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 FUNDING
 
Expression of Rice NRR in Arabidopsis Results in Suppression of PR Gene Expression and Impaired Resistance to Pseudomonas syringae
The rice NRR gene was isolated based on interaction of its gene product with the Arabidopsis NPR1 protein in yeast (Chern et al., 2005a). We then tested whether NRR would affect NPR1-mediated SAR response in Arabidopsis, normally represented by induction of PR genes after treatment with SA or INA. We introduced a 35S-NRR construct into wild-type Arabidopsis (carrying a BG2-Gus reporter gene (BG2 = PR-2); Cao et al., 1994).

Many lines of 35S-NRR transgenic Arabidopsis were obtained and analyzed by a qualitative GUS histochemical staining assay. Most of them showed reduced GUS expression levels compared with the wild-type control after INA pre-treatment (data not shown). Northern blot analysis was then used to assess RNA expression levels quantitatively. Figure 1 shows RNA expression levels from RNA blotting experiments of two (NRR-9 and NRR-12) of the 35S-NRR lines along with wild-type (WT) and npr1-1 controls. NRR-9 and NRR-12 show expression of NRR RNA, which is absent in WT and npr1-1. After treatment with INA (0.65 mM), PR-1 and PR-5 transcripts are highly induced whereas induction is impaired in npr1-1, except for the mild induction of PR-5. NRR-9 and NRR-12, like npr1-1, both failed to respond to INA induction. Interestingly, the levels of PR-5 expression in NRR-9 and NRR-12 after induction are even lower than in the npr1-1 mutant.


Figure 1
View larger version (87K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. RNA Blot Analysis of PR Gene Expression after INA Induction.

Wild-type (WT) Arabidopsis, npr1-1 mutant, and transgenic Arabidopsis (NRR-9 and NRR-12) carrying 35S-NRR were treated with 0.65 mM INA. Two days later, tissues were collected and total RNA extracted from these samples. 10 micro grams of total RNA was loaded in each lane. The RNA blotted on a nitrocellulose membrane was probed with PR-1, PR-5, NRR, and 25S rRNA sequentially.

 
When these transgenic Arabidopsis plants were inoculated with Pseudomonas syringae pv. tomato (Pst) DC3000 at high concentration (106 cfu mL–1) by syringe-infiltration, infected leaves of NRR-9 and NRR-12 collapsed in 2 d, as shown in Figure 2A. Figure 2A also shows that leaves of npr1-1 partially collapsed while those of wild-type showed only mild speck symptoms.


Figure 2
View larger version (49K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Symptoms of Infected Arabidopsis and Growth Curves of P. syringae.

(A) Leaf samples were taken 2 d after infection with Pst at a concentration 106 cfu mL–1.

(B) Arabidopsis plants were infected with Pst at 105 cfu mL–1 2 d after treatment with 0.65 mM INA. Leaf samples were taken 1 week after infection.

(C) Growth curves of Pst. Arabidopsis leaves were syringe-infiltrated with Pst at 105 cfu mL–1. For each sample, three leaves were pooled to extract Pst and the colony number was normalized to the weight of the leaves. Each data point represents the average and standard deviation of four samples.

 
To test possible effects on SAR, these plants were sprayed with 0.65 mM INA to induce SAR and, 3 d afterwards, inoculated with Pst DC3000 at a lower concentration (105 cfu mL–1) by syringe-infiltration. Leaf samples of these inoculated plants are shown in Figure 2B, where NRR-9 and NRR-12 displayed severe bacterial speck disease symptoms a week after inoculation. The npr1-1 mutant only exhibited mild disease symptoms. On the contrary, the wild-type remained little affected. Figure 2C shows the growth curves conducted on these plants in the same experiment. For each sample, three leaves were pooled to extract Pst and the colony number was normalized to the weight of the leaves. The bacterial growth curves confirm that NRR-9 and NRR-12 are severely impaired in resistance to Pst DC3000 as they harbored several orders more Pst than the wild-type. The growth curves also confirmed that NRR-9 and NRR-12 are also more susceptible to Pst than the npr1-1 mutant. t-tests give p values of 0.001 and 0.0001, respectively, for NRR-9 and NRR-12 compared with the npr1-1 mutant, showing highly significant differences.

These results suggest that ectopically expressed NRR greatly suppresses normal defense responses, including SAR, in Arabidopsis, leading to hyper-susceptibility to Pst DC3000. Moreover, these plants were more severely diseased than the npr1-1 mutant, which is impaired in SAR. Consistent with these observations are the data showing that NRR-9 and NRR-12 express lower levels of PR-5 than npr1-1 after INA induction.

NRR Mutants that Have Lost the Ability to Interact with NPR1 Lose the Ability to Suppress SAR in Arabidopsis
Previously, we have determined that the ability of NRR to interact with NPR1 depends on an NPR1-interacting (NI) domain comprising 25 amino acids (amino acids 28–52). Figure 3A summarizes schematically the relative locations of the NI domain and three point mutations within it. As previously reported, two of the single point mutations—F40G (FG) and L44G (LG)—at amino acids conserved with NIMIN2 lead to the loss of most of the ability to interact with NPR1 in yeast, while E39K (EK) has little effect on interaction with NPR1 (Chern et al., 2005). To see whether the ability of NRR to suppress disease resistance is correlated with its ability to interact with NPR1, we transformed Arabidopsis with NRR mutants FG and LG under control of the 35S promoter. For comparison, transgenic Arabidopsis carrying the wild-type NRR and mutant EK were also generated.


Figure 3
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Gene Expression from the BG2 Promoter after Induction.

(A) A schematic graph of the NRR protein depicting the locations of point mutations EK, FG, and LG.

(B) After selection on medium containing hygromycin, 18 independent T1 transgenic Arabidopsis carrying either wild-type NRR, EK, FG, or LG were transferred to plates containing INA to induce expression from the BG2 promoter. GUS enzyme activity was assayed for each plant 3 d later. Three untransformed BG2 (WT) and three npr1-1 plants (in BG2 background) were also assayed for comparison. Each dot represents the GUS activity of one plant.

(C) Progeny of two lines from each construct were selected for the GUS assay, along with the WT and npr1-1 controls. Five plants of each line were assayed individually after INA induction. Each bar represents the average and standard deviation of five plants.

 
To assess the effects on expression of PR genes, we took advantage of the BG2-Gus reporter, in which the Gus gene is under control of an INA-responsive β-1,3-glucanase (BG2) promoter, in the recipient by assaying the GUS activity. After selection for the presence of the antibiotic resistance transformation marker, 18 independent T1 transgenic Arabidopsis carrying either wild-type NRR, EK, FG, or LG transgene were transferred to plates containing INA to induce expression from the BG2 promoter. Quantitative GUS enzyme activity was assayed for each plant 3 d afterwards. For comparison, GUS activity of three untransformed BG2 (WT) and three npr1-1 plants (in the BG2 background) were assayed.

The GUS activity data were plotted in Figure 3B, where each dot represents one plant. Consistent with previous observations, the GUS activities of the majority of NRR plants shifted downward towards that of npr1-1. Plants of the EK mutants responded like the NRR plants. The FG plants responded similarly to WT. The LG plants also behaved similarly to WT, despite having a much broader distribution. To confirm these results, progeny of two lines from each construct were selected for the GUS assay. Five plants of each line were assayed individually after INA induction and the results are shown in Figure 3C. Figure 3C confirms the observations that NRR and EK transgenic Arabidopsis plants behave like npr1-1 whereas FG and LG transgenic plants responded similarly to wild-type Arabidopsis. Together, these data suggest that while NRR and EK suppress PR gene induction, FG and LG, which lost the ability to interact strongly with NPR1, lose the suppression. Therefore, the ability of NRR to suppress PR gene induction is correlated with its ability to interact with NPR1.

These transgenic Arabidopsis plants were also tested for response to challenge by Pst DC3000. They were syringe-infiltrated with Pst DC3000 at a concentration of 105 cfu mL–1 after treatment with INA. Figure 4A shows the bacterial growth curves in the different transgenic plants. Consistent with the effects on PR genes, the FG and LG mutants behaved similarly to wild-type while NRR and EK responded like npr1-1. Figure 4B shows a typical leaf from each plant 7 d after inoculation. Similarly, NRR and EK plants showed severe speck disease and npr1-1 was mildly diseased. On the contrary, the FG and LG plants, like wild-type, showed few signs of the disease.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. Growth Curves of P. syringae and Bacterial Speck Symptoms of Arabidopsis Carrying Wild-Type NRR and NRR Mutants.

(A) Growth curves of Pst. The inoculation and growth curves were done the same way as described in Figure 2B and 2C.

(B) Bacterial speck symptoms of WT Arabidopsis, npr1-1, and Arabidopsis carrying wild-type NRR, mutants EK, FG, and LG, after infection with Pst.

(C) Western blot analysis. Equal amounts (200 micro grams) of protein extracted from WT Arabidopsis, Arabidopsis carrying wild-type NRR, mutants EK, FG, and LG were loaded, run on a gel, and blotted to a nitrocellulose membrane. The membrane was probed with an antiserum raised against the C-terminal 83 amino acids of NRR, excluding the NI domain, where the three mutations are located.

 
To confirm that the protein was expressed in the individual transgenic plant, immunoblot analysis was performed. Protein extracted from the lines was blotted on a nitrocellulose membrane and probed with antibodies raised against a peptide corresponding to the C-terminal half of NRR. Figure 4C shows that the mutant FG and LG proteins are at least as stable as the wild-type NRR and EK proteins. Thus, loss of the suppression effects in FG and LG cannot be accounted for by protein instability.

A Domain Swap Turns NRR into a Transcriptional Activator that Enhances Disease Resistance
The observation that NRR suppresses induction of PR gene suggests that it may contain a repression domain and act as a transcriptional repressor when bound to NPR1. One way to test this is to swap out the possible repression domain in NRR. NRR is a small protein made of 131 amino acids. Its N-terminal half contains a nuclear localization signal and the NPR1-interacting domain; its C-terminal half is proline- and alanine-rich and contains an LDLNxxP sequence, resembling the ERF-associated amphiphilic repression (EAR) motif (Ohta et al., 2001; Chern et al., 2005a), near the C-terminal end. To swap out the putative repression domain, the N-terminal first 52 amino acids of NRR was fused to a VP16 activation domain (replacing the C-terminal 79 amino acids), resulting in a fusion protein NIAD. The ability of the NIAD fusion protein to bind to NPR1 strongly was demonstrated previously in yeast two-hybrid (Chern et al., 2005).

The NIAD construct was transformed into Arabidopsis under control of a maize ubiquitin promoter (Christensen and Quail, 1996). Progeny of five lines were assayed for GUS activity from the BG2-Gus reporter gene after 0.1 mM INA induction of PR gene expression. Figure 5A shows the GUS activity of the average of three plants. Lines NIAD-10 and NIAD-12 showed much higher GUS activity than the wild-type. NIAD-22 showed only slightly higher GUS activity in Figure 5A, but, when the assay was repeated with more plants, it exhibited a two-fold higher GUS activity than WT (data not shown).


Figure 5
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. PR Gene Expression after Induction and P. syringae Growth Curves in NIAD Plants.

(A) GUS activity driven by the BG2 promoter after INA induction. Along with the WT, five lines of NIAD transgenic Arabidopsis were assayed for GUS activity expressed from the BG2-Gus reporter gene after INA induction to induce PR gene expression. Each bar represents the average and standard deviation of three plants.

(B) Growth curves of Pst. Arabidopsis plants were sprayed with 0.1 mM INA 24 h before syringe-infiltration with Pst at 105 cfu mL–1. Growth curves were done similarly as described in Figure 2C. Each data point represents the average and standard deviation of three samples.

 
These three NIAD lines (NIAD-10, NIAD-12, and NIAD-22) along with the wild-type control were challenged with Pst DC3000 1 d after induction by INA. We chose to spread the plants with 0.1 mM INA instead of 0.65 mM INA because 0.65 mM INA strongly induces SAR and can easily mask any possible enhanced resistance responses. Figure 5B shows the bacterial growth curves in these plants, where each data point represents three repeats. The bacterial populations in all three NIAD lines are lower than in the wild-type. At day 4 after inoculation, the average bacterial populations in the wild-type are approximately four- to five-fold larger than those in the three NIAD lines. When the nine data points of all three NIAD lines are taken into consideration, the t-test gives a p value of 0.0023, demonstrating a highly significant difference between NIAD and the wild-type control. Together, these results show that expression of the NIAD fusion protein enhances induction of PR gene expression after INA treatment, leading to higher resistance to Pst DC3000. These data also indicate that the NIAD fusion protein functions as a transcriptional activator when bound to NPR1 in Arabidopsis.


    DISCUSSION
 TOP
 Abstract
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 FUNDING
 
We have shown that expression of the rice NRR in Arabidopsis results in severe suppression of the SAR response. This suppression is dependent on the ability to interact with the NPR1 protein. These results suggest that NRR binds directly to NPR1 in vivo to inhibit the function of NPR1. Arabidopsis NPR1 is thought to act as a transcriptional co-activator as demonstrated in a transient assay system (Rochon et al., 2006). NRR contains an EAR-like motif (LDLNxxP) near its C-terminus (Chern et al., 2005a). Thus, NRR most likely acts as a transcriptional repressor by active repression. Indeed, replacing the C-terminal 79 amino acids of NRR with a VP16 activation domain turns the fusion protein NIAD into a co-activator. Expression of the fusion protein NIAD in Arabidopsis leads to stronger activation of the BG2 (PR-2) promoter, which is representative of PR genes, after INA induction of the SAR response. An unlikely scenario remains that the higher BG2-GUS expression and resistance to P. syringae results from squelching by an overexpressed transcriptional activation domain, namely the VP16 activation domain. Our data strongly suggest that NIAD is present in a complex with NPR1 and TGA that binds to and activates the BG2 promoter. It therefore indicates that NRR probably forms a complex with NPR1 and TGA in vivo to act as a transcriptional repressor.

It is interesting that expression of NRR in Arabidopsis results in suppression of the INA-induced SAR response, including activation of the PR-5 gene and resistance to Pst, even more severe than the npr1-1 mutation does. Weigel et al. (2005) showed that constitutive expression of Arabidopsis NIMIN1 in Arabidopsis led to an npr1-1 like phenotype, but no phenotypes more severe than npr1-1 were reported. These results indicate that there are differences between rice NRR and Arabidopsis NIMIN1 despite their ability to bind to NPR1. Rice NRR may carry a more potent transcriptional repression domain, which may be lacking in Arabidopsis NIMIN1. How does constitutive expression of NRR suppress SAR more severely than the npr1-1 mutant? It could be because the npr1-1 mutation still carries some residual NPR1 activity while NRR completely inhibits NPR1 function to induce PR gene expression. Another possible scenario is that NRR may also inhibit components other than NPR1. It is known that there are SA-dependent but NPR1-independent pathways leading to activation of PR genes. For example, the Arabidopsis ssi mutation causes accumulation of SA, leading to constitutive expression of PR-1, PR-2, and PR-5 in the npr1-5 background (Shah et al., 1999). In another case, sucrose is shown to increase PR-2 and PR-5 gene expression through an SA-dependent but NPR1-independent pathway (Thibaud et al., 2004). NRR may inhibit one of the components involved in one of these NPR1-independent pathways.

It is conceivable that NRR may interact with Arabidopsis NPR1 paralogs, such as NPR2, NPR3, and NPR4, since NRR interacts with paralogs of NH1 (rice NPR1 homolog 1) in rice (Chern, M. unpublished). However, since Arabidopsis NPR3 and NPR4 are shown to negatively regulate both NPR1-dependent and NPR1-independent pathways and PR gene expression (Zhang et al., 2006), NRR is not likely to inhibit NPR3 and NPR4 directly. No biological function of the Arabidopsis NPR2 gene has been reported so far. It remains possible that NPR2 may have partial overlapping function with NPR1 in mediating the SA signaling pathway and that it may mediate partial activation of PR gene expression when NPR1 is no longer functional. It is possible that NRR interacts with Arabidopsis NPR2 and interferes with NPR2 function.


    METHODS
 TOP
 Abstract
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 FUNDING
 
Generation of Mutant Constructs and Transgenic Arabidopsis
A 35S–C1300 vector was first created by cloning the CaMV 35S promoter and a nos 3’ terminator sequence into the pCambia 1300 vector. Wild-type NRR and mutant genes EK, FG, and LG were then cloned into the BamHI site behind the 35S promoter to generate 35S-NRR/C1300, 35-EK/C1300, 35S-FG/C1300, and 35S-LG/C1300. The Ubi–NIAD construct was created by cloning the NIAD gene chimera (a BamHI/KpnI fragment) into the BamHI and KpnI sites in the Ubi–C1300 vector. Generation of NRR single point mutants E39K, F40G, L44G, and chimera NIAD containing the first 52 amino acids (NI) and VP16 activation domain (AD) has been described before (Chern et al., 2005a).

To generate transgenic Arabidopsis, each of the constructs described above was used to transform Agrobaterium EHA105, which was then used to transform Arabidopsis thaliana Col using a dipping method (Bechtold et al., 1993). Arabidopsis seeds were germinated on MS (Murashige and Skoog) medium containing 50 mg L–1 hygromycin for selection.

SAR Induction by INA Treatment
For quantitative GUS activity measurement, the plants were grown for several days on MS basal medium agar plates containing 0.1 mM INA. The plant was ground up in GUS buffer and GUS enzyme activity assay was performed as described by Jefferson (1987). For P. syringae disease testing and RNA extraction, plants were grown on soil for several weeks and 0.1 or 0.65 mM INA was spread by foliar application 1–3 d before the assays.

RNA Blot Analysis and P. syringae Disease Testing
Total RNA was extracted from harvested tissue using the Trizol reagent (Invitrogen) according to the manufacturer's instructions. RNA was run on denaturizing agarose gels containing formaldehyde. The RNA was then transferred to a nitrocellulose membrane and hybridized to different probes. P. syringae was re-suspended in 10 mM MgSO4 solution at the desired concentration and infiltrated into each leaf by a 1-mL syringe. For P. syringae growth curves, three leaves were collected for each data point and ground up in 10 mM MgSO4 solution to extract the bacteria. Bacteria were plated out at a series of dilution on NYGA (0.5% peptone, 0.3% yeast extract, 2% glycerol, and 1.5% agar) medium containing rifampicin (25 mg L–1).

Generation of Polyclonal Antibodies against NRR
A DNA fragment corresponding to the C-terminal 83 amino acids of NRR (NRRC) was PCR-amplified with primers NRRC-pET (TTTCATATGGACGCCACCCGACGGCTC) and mn45-4 (AGGATCCACTAGTCTCGAGTTGTAATCCGTGAGCA). The PCR product was purified and digested with NdeI + BamHI and cloned in-frame into vector pET15b, pre-digested with NdeI and BamHI. The NRRC peptide was expressed in E. coli BL21(DE3)pLysS cells and purified with Ni-NTA agarose resins, as described before. The purified NRRC peptide was used to inject rabbits to raise polyclonal antisera. The antisera were tested against E. coli protein extracts with and without NRR to confirm specificity.


    FUNDING
 TOP
 Abstract
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 FUNDING
 
This project was supported by a grant from USDA (Functional Genomics of Agriculturally Important Organism; 2004-63560416640) to P.C.R.


    Acknowledgements
 
We are highly grateful to Dr Xinnian Dong of Duke University for providing us with the Arabidopsis BG2 and npr1-1 lines. No conflict of interest declared.

    Bechtold N, Ellis J, Pelletier G. In planta Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. C.R. Acad. Sci. Paris, Life Sciences (1993) 316:1194–1199.

    Cao H, Bowling SA, Gordon AS, Dong X. Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell (1994) 6:1583–1592.[Abstract]

    Cao H, Glazebrook J, Clarke J, Volko S, Dong X. The Arabidopsis npr1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell (1997) 88:57–63.[CrossRef][Web of Science][Medline]

    Cao H, Li X, Dong X. Generation of broad-spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance. Proc. Natl Acad. Sci. U S A (1998) 95:6531–6536.[Abstract/Free Full Text]

    Chern M, Canlas PE, Fitzgerald HA, Ronald PC. Rice NRR, a negative regulator of disease resistance, interacts with Arabidopsis NPR1 and rice NH1. Plant J (2005a) 43:623–635.[CrossRef][Web of Science][Medline]

    Chern M, Fitzgerald HA, Canlas PE, Navarre DA, Ronald PC. Over-expression of a rice NPR1 homologue leads to constitutive activation of defense response and hypersensitivity to light. Mol. Plant–Microbe Interact (2005b) 18:511–520.[Web of Science][Medline]

    Chern M-S, Fitzgerald HA, Yadav RC, Canlas PE, Dong X, Ronald PC. Evidence for a disease-resistance pathway in rice similar to the NPR1-mediated signaling pathway in Arabidopsis. Plant J (2001) 27:101–113.[CrossRef][Web of Science][Medline]

    Christensen AH, Quail PH. Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Res (1996) 5:213–218.[CrossRef][Web of Science][Medline]

    Delaney TP, Friedrich L, Ryals JA. Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance. Proc. Natl Acad. Sci. U S A (1995) 92:6602–6606.[Abstract/Free Full Text]

    Despres C, DeLong C, Glaze S, Liu E, Fobert P. The Arabidopsis npr1/nim1 protein enhances the DNA binding activity of a subgroup of the TGAfamily of bZIP transcription factors. Plant Cell (2000) 12:279–290.[Abstract/Free Full Text]

    Fan W, Dong X. In vivo interaction between NPR1 and transcription factor TGA2 leads to salicylic acid-mediated gene activation in Arabidopsis. Plant Cell (2002) 14:1377–1389.[Abstract/Free Full Text]

    Friedrich L, et al. A benzothiadiazole derivative induces systemic acquired resistance in tobacco. Plant J (1996) 9:61–70.

    Friedrich L, Lawton K, Dietrich R, Willitis M, Cade R, Ryals J. NIM1 overexpression in Arabidopsis potentiates plant disease resistance and results in enhanced effectiveness of fungicides. Mol. Plant–Microbe Interact (2001) 9:1114–1124.

    Glazebrook J, Rogers EE, Ausubel FM. Isolation of Arabidopsis mutants with enhanced disease susceptibility by direct screening. Genetics (1996) 143:973–982.[Abstract]

    Jefferson RA. Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol. Biol. Rep (1987) 5:387–405.[CrossRef]

    Johnson C, Boden E, Arias J. Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to a defense gene promoter in Arabidopsis. Plant Cell (2003) 15:1846–1858.[Abstract/Free Full Text]

    Kinkema M, Fan W, Dong X. Nuclear localization of NPR1 isrequired for activation of PR gene expression. Plant Cell (2000) 12:2339–2350.[Abstract/Free Full Text]

    Mou Z, Fan W, Dong X. Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell (2003) 113:1–10.[CrossRef][Web of Science][Medline]

    Ohta M, Matsui K, Hiratsu K, Shinshi H, Ohme-Takagi M. Repression domains of class II ERF transcriptional repressor share an essential motif for active repression. Plant Cell (2001) 13:1959–1968.[Abstract/Free Full Text]

    Ryals J, et al. The Arabidopsis NIM1 protein shows homology to the mammalian transcription factor inhibitor I{kappa}B. Plant Cell (1997) 9:425–439.[Abstract]

    Ryals JA, Neuenschwander UH, Willits MG, Molina A, Steiner H-Y, Hunt MD. Systemic acquired resistance. Plant Cell (1996) 8:1809–1819.[CrossRef][Web of Science][Medline]

    Shah J, Kachroo P, Klessig DF. The Arabidopsis ssi1 mutation restores pathogenesis-related gene expression in npr1 plants and renders defensin gene expression salicylic acid dependent. Plant Cell (1999) 11:191–206.[Abstract/Free Full Text]

    Shah J, Tsui F, Klessig DF. Characterization of a salicylic acid-insensitive mutant (sai1) of Arabidopsis thaliana, identified in a selective screen utilizing the SA-inducible expression of the tms2 gene. Mol. Plant Microbe Interact (1997) 10:69–78.[Web of Science][Medline]

    Thibaud M-C, Gineste S, Nussaume L, Robaglia C. Sucrose increases pathogenesis-related PR-2 gene expression in Arabidopsis thaliana through an SA-dependent but NPR1-independent signaling pathways. Plant Physio. Biochem (2004) 42:81–88.[CrossRef]

    Weigel RR, Bauscher C, Pfitzner AJ, Pfitzner UM. NIMIN-1, NIMIN-2 and NIMIN-3, members of a novel family of proteins from Arabidopsis that interact with NPR1/NIM1, a key regulator of systemic acquired resistance in plants. Plant Mol. Biol (2001) 46:143–160.[CrossRef][Web of Science][Medline]

    Weigel RR, Pfitzner UM, Gatz C. Interaction of NIMIN1 with NPR1 modulates PR gene expression in Arabidopsis. Plant Cell (2005) 17:1279–1291.[Abstract/Free Full Text]

    Zhang Y, Cheng YT, Qu N, Zhao Q, Bi D, Li X. Negative regulation of defense responses in Arabidopsis by two NPR1 paralogs. Plant J (2006) 48:647–656.[CrossRef][Web of Science][Medline]

    Zhang Y, Fan W, Kinkema M, Li X, Dong X. Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. Proc. Natl Acad. Sci. U S A (1999) 96:6523–6528.[Abstract/Free Full Text]

    Zhang Y, Tessaro MJ, Lassner M, Li X. Knockout analysis of Arabidopsis transcription factors TGA2, TGA5, and TGA6 reveals their redundant and essential roles in systemic acquired resistance. Plant Cell (2003) 15:2647–2653.[Abstract/Free Full Text]

    Zhou JM, Trifa Y, Silva H, Pontier D, Lam E, Shah J, Klessig D. NPR1 differentially interacts with members of the TGA/OBF family of transcription factors that bind an element of the PR-1 gene required for induction by salicylic acid. Mol. Plant–Microbe Interact (2000) 13:191–202.[Web of Science][Medline]

    Zwicker S, Mast S, Stos V, Pfitzner AJP, Pfitzner UM. Tobacco NIMIN2 proteins control PR gene induction through transient repression early in systemic acquired resistance. Mol. Plant Pathol (2007) 8:385–400.[CrossRef]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
1/3/552    most recent
ssn017v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chern, M.
Right arrow Articles by Ronald, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?