Skip Navigation



Molecular Plant Advance Access published online on August 13, 2008
Molecular Plant, doi:10.1093/mp/ssn042
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
1/5/794    most recent
ssn042v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Oh, S.-A.
Right arrow Articles by Twell, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPP and IPPE, SIBS, CAS.

Arabidopsis Kinesins HINKEL and TETRASPORE Act Redundantly to Control Cell Plate Expansion during Cytokinesis in the Male Gametophyte

Sung-Aeong Oha,c, Valérie Bourdonb, Madhumita Das ‘Pala, Hugh Dickinsonb and David Twella,1

a Department of Biology, University of Leicester, University Road, Leicester LE1 7RH, UK
b Department of Plant sciences, University of Oxford, South Parks Road, Oxford OX1 3RB, UK
c Present address: Division of Plant Biosciences, Kyungpook National University, Daegu 702-701, South Korea

1 To whom correspondence should be addressed. E-mail twe{at}le.ac.uk, fax +44(0)116 2523330, tel. +44(0)116 2522281.


   Abstract
TOP
 Abstract
INTRODUCTION
 RESULTS AND DISCUSSION
 METHODS
 SUPPLEMENTARY DATA
 FUNDING
 
Asymmetric cell division at pollen mitosis I (PMI) is required to specify the differential fate of the daughter vegetative and generative cells. Cytokinesis at PMI displays specialized features, and it has been suggested that there might be distinct molecular pathways underpinning different modes of cytokinesis in plants. Activation of the NACK–PQR MAP kinase signaling pathway, which is essential for somatic cell cytokinesis in tobacco, depends upon the NACK1 and NACK2 kinesin-related proteins. Their Arabidopsis orthologs, HINKEL (HIK) and TETRASPORE (TES), were reported to be essential for cytokinesis in somatic cells and in microsporocytes, respectively. More recently, HIK and TES were shown to have a functionally redundant role in female gametophytic cytokinesis. We report here that HIK and TES are co-expressed in microspores and developing pollen, and, through analysis of microspore and pollen development in double heterozygote mutants, the occurrence of cell plate expansion defects during cytokinesis at PMI. The data demonstrate a functionally redundant role for HIK and TES in cell plate expansion during male gametophytic cytokinesis, extending the concept that different modes of cytokinesis are executed by a common signaling pathway, but reinforcing the individuality of gametophytic cytokinesis in its requirement for either TES or HIK.


   INTRODUCTION
TOP
 Abstract
 INTRODUCTION
RESULTS AND DISCUSSION
 METHODS
 SUPPLEMENTARY DATA
 FUNDING
 
The lifecycle of all multi-cellular organisms depends on regulated cell division, which involves separation of both the nucleus (mitosis/karyokinesis) and the cytoplasm (cytokinesis). Many features of ‘nuclear’ mitosis appear to be conserved, but cytokinesis differs considerably between plants and animals. In animal cells, cytokinesis is initiated by the formation of a cleavage furrow at the parental plasma membrane, which then constricts, inwardly driven by a contractile actomyosin ring (Eggert et al., 2006). Plant cytokinesis conventionally involves the formation of a ‘cell plate’ between the two daughter nuclei, which extends centrifugally outwards until it contacts the plasma membrane. In somatic cells, this process commences during anaphase with the appearance of the phragmoplast, consisting of two anti-parallel arrays of actin filaments and microtubules (Staehelin and Hepler, 1996). Mutant studies suggest that kinesins deliver vesicles along these phragmoplast microtubules, and both the membrane and cargo of these vesicles contribute to the nascent cell plate, which grows outwards within the plane of future division, marked by the pre-prophase band (PPB) (for review, see Jurgens, 2005). As the cell plate expands, microtubules depolymerize at the centre of the phragmoplast and tubulin monomers are recruited to the leading edge of the phragmoplast, creating new microtubules that guide new vesicles to the margins of the expanding cell plate. Eventually, the cell plate becomes fused with the plasma membrane, leading to stabilization and maturation of the new cell wall (Jurgens, 2005).

Other forms of cytokinesis occur in specialized plant cells (Otegui et al., 2000), and are not always associated with nuclear division. For example, so-called ‘non-conventional’ cytokinesis is found in the meiotic divisions of both sexes, and during megagametophyte and endosperm cellularization. Here, multinucleate cells (coenocytes) undergo simultaneous cytoplasmic compartmentation by cell walls. Although cytokinesis in male gametophytic cells is seemingly similar to that of the sporophyte (termed conventional), with cytokinesis at PMI immediately following mitosis, it involves some specialized features. First, the site of asymmetric division is linked to nuclear and spindle position and is not guided by a PPB. Second, the phragmoplast and cell plate are modified to form a hemispherical structure enclosing the generative nucleus (Brown and Lemmon, 1992; Terasaka and Niitsu, 1995; Park et al., 1998). This type of cell division thus falls between conventional and non-conventional cytokinesis—containing elements of each type. An important first step in understanding the functional and evolutionary differences between these three forms of plant cytokinesis must be to compare the molecular regulation of these events.

Cytokinesis-associated genes can be grouped into three classes according to their predicted activities: membrane-associated, cytoskeleton-associated, and ‘other’ (Jurgens, 2005). Importantly, the function of the majority of these genes has not been analyzed in different cell types; for example, many genes reported to be essential for cytokinesis in somatic cells have either not been studied in or have been regarded as non-essential for male gametophytic cytokinesis. Strikingly, some genes essential for cytokinesis at PM I have emerged as being important for other types of cytokinesis. For instance, mutations in the MOR1/GEM1 (encoding an XMAP215-related microtubule-associated protein) and GEM2 genes affect cytokinesis not only in microspores, but also in roots and embryo sacs (Park et al., 1998, 2004; Twell et al., 2002). Similarly, mutations in TWO-IN-ONE (TIO) (encoding a unique plant FUSED Ser/Thr kinase) lead to cytokinetic defects both in male and female gametophytes and in somatic cells (Oh et al., 2005).

The NACK proteins play a central role in cytokinesis in tobacco. They are predicted kinesins that activate the NACK–PQR pathway, which positively regulates cell plate expansion via a sequence of phosphorylations of MAP kinase cascade components (Nishihama et al., 2002; Soyano et al., 2003; Takahashi et al., 2004). HINKEL/AtNACK1 and TETRASPORE/AtNACK2 are the Arabidopsis orthologs of these genes (see Figure 1A; Nishihama et al., 2002; Tanaka et al., 2004), and tetraspore (tes) mutants show male-meiosis specific cytokinesis defects only (Spielman et al., 1997; Yang et al., 2003), while disruption of HINKEL is embryo lethal (Strompen et al., 2002), implying there may be cell type-specific requirements for these two putative kinesins. Importantly, HIK and TES have been shown to have functionally redundant roles during cellularization of the embryo sac (Tanaka et al., 2004). Whether HIK and TES act in a similar fashion in cytokinesis in the male gametophyte remains to be established.


Figure 1
View larger version (49K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 1. Sequence Comparison and Expression Analysis of HIK and TES.

(A) Cladogram tree based on amino acid sequences of HIK and TES with orthologs in tobacco, calculated using CLUSTALW with default parameters (www.ebi.ac.uk/Tools/clustalw2/index.html).

(B) RT–PCR analysis of HIK and TES expression at different stages of pollen development. Primers specific for KAPP (kinase-associated protein phosphatase) were used as a control. KAPP transcripts are expressed cumulatively during pollen maturation and in seedlings at three to four-fold lower levels (see aGFP database; Dupl'áková et al., 2007). Sizes of bands correspond to the predicted sizes for amplified cDNA sequences.

 
We show here that both HIK and TES are expressed during male gametophyte development, and play a functionally redundant role in PMI. Our data suggest that although the various modes of plant cytokinesis may differ considerably in their molecular mechanics, they all involve the NACK–PQR signaling pathway.


   RESULTS AND DISCUSSION
TOP
 Abstract
 INTRODUCTION
 RESULTS AND DISCUSSION
METHODS
 SUPPLEMENTARY DATA
 FUNDING
 
HIK and TES Are Co-Expressed during Male Gametogenesis
Both HIK and TES are expressed in tissues that contain proliferating cells, with HIK more highly expressed in young plants (Tanaka et al., 2004). Since no data were available for the male gametophyte, HIK and TES expression was investigated during microgametogenesis. RNA was isolated from spores at four stages of pollen development: uninucleate microspores, bicellular pollen, tricellular pollen, and mature pollen, as described (Honys and Twell, 2004). Semi-quantitative RT–PCR analysis was employed using primers specific for HIK and TES (primer efficiency was similar using cloned cDNAs as templates (data not shown)). The results demonstrate HIK to be strongly expressed in seedlings and in microspore and bicellular pollen (Figure 1B). HIK expression is reduced in tricellular pollen and absent from mature pollen. A similar analysis of TES expression showed expression in seedlings and in all four stages of pollen development, with expression in mature pollen strongly reduced (Figure 1B). Moreover, TES expression was consistently higher than HIK. In seedlings, expression of HIK was higher than TES, in accordance with previous analysis (Strompen et al., 2002; Tanaka et al., 2004).

Double Mutant hik-1;tes-1 Gametes Are Not Transmitted
To examine the effects of hik and tes mutations on male gametogenesis, we generated double heterozygote plants carrying hik-1 (Strompen et al., 2002) and tes-1 alleles (Spielman et al., 1997). Since homozygous hik-1 seedlings are not viable, we crossed heterozygote hik-1 with heterozygote tes-1 plants. F1 plants were PCR genotyped and F2 seed from double heterozygotes was harvested. We genotyped 52 randomly chosen plants from an F2 population (Table 1). As reported by Tanaka et al. (2004), for different atnack1(hik) and atnack2 (tes) alleles, we found that the three genotypic combinations (hik-1/hik-1;tes-1/tes-1, hik-1/HIK;tes-1/tes-1, and hik-1/hik-1;tes-1/TES) that would confirm gametophytic transmission of hik-1/tes-1 gametes were absent from the F2 population (Table 1). Taken together, these data confirm that at least one wild-type copy of either HIK or TES is required in gametes to produce viable progeny.


View this table:
[in this window]
[in a new window]

  		Table 1. Genotypes of F2 Progeny Derived from a hik-1/HIK;tes-1/TES Parent Plant.

 
Double Mutant hik-1/tes-1 Microspores Initiate, But Fail to Complete Cytokinesis at Pollen Mitosis I
To determine at what stage development is disrupted in hik/tes pollen, the pollen phenotypes of all F2 plants were investigated, except for hik-1/hik-1 plants, which die during vegetative growth. Multiple plants of each genotypic class were used to score the frequency of mutant pollen phenotypic classes (summarized in Supplemental Table 1 and Figure 2). Plants carrying more than three wild-type copies for two kinesin genes, TES/TES;HIK/HIK, tes-1/TES;HIK/HIK and TES/TES;hik-1/HIK, produced normal tricellular pollen (Figure 2A–2C), suggesting that one wild-type copy of either HIK or TES in microspores is sufficient to produce morphologically normal pollen. Homozygous tes-1/tes-1 plants showed large tetrasporous pollen, often with multiple pairs of sperm cells, resulting from meiotic cytokinesis defects (Figure 2D; Spielman et al., 1997). In contrast, double heterozygous mutant plants (hik-1/HIK;tes-1/TES) showed ~23% aberrant pollen with unique phenotypes that were not observed in other genotypes (Table 2). In open flowers, aberrant pollen comprised ~5.5% binucleate, ~5.8% uninucleate, and 11.7% collapsed pollen (Figure 2E–2H; Supplemental Table 1). The combined frequency of aberrant pollen is close to that expected (25%) for pollen carrying both hik-1 and tes-1 mutant alleles, providing evidence that HIK and TES can complement each other during male gametogenesis and that depletion of both products disrupts cytokinesis.


View this table:
[in this window]
[in a new window]

  		Table 2. Frequency of Mutant Phenotypes in hik-1/HIK;tes-1/TES Plants During Pollen Development.

 


Figure 2
View larger version (48K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 2. Pollen Phenotypes of Siblings from a hik-1/HIK;tes-1/TES Double Heterozygote Parent Plant.

Mature pollen was stained with DAPI from plants with genotypes:

(A) HIK/HIK;TES/TES.

(B) hik-1/HIK;TES/TES.

(C) HIK/HIK;/tes-1/TES.

(D) HIK/HIK;tes-1/tes-1.

(E–H) hik-1/HIK;tes-1/TES pollen phenotypes, (E) Wt, (F) binucleate, (G) uninucleate, (H) aborted.

Scale bars depict 10 µm.

 
To determine the nature of these defects in cell division, isolated DAPI-stained spores were examined throughout development in double heterozygote plants (Figure 3 and Table 2). In early-stage anthers, meiotic division occurred normally, resulting in tetrads (not shown) and free microspores—each with a brightly stained central nucleus (Figure 3A and 3F). At late microspore stage, polar nuclear migration and asymmetric nuclear division at PMI occurred normally, giving rise to two morphologically distinct daughter nuclei (Figure 3B–3C, 3G and 3H). The larger vegetative nucleus chromatin remained dispersed compared to that of the smaller generative nucleus, which was condensed and partly flattened against the pollen wall, as in wild-type pollen development (Figure 3C and 3H). In early bicellular stage anthers of double heterozygous mutants, ~75% of developing pollen grains showed the generative cell still attached to the pollen wall with clear cytoplasmic separation between the two nuclei as in wild-type (Figure 3C). However, in the remaining ~25% of the population, the two nuclei were not clearly separated, suggesting either the absence or the disruption of the intervening cell wall (Figure 3H and Table 2).


Figure 3
View larger version (34K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 3. Pollen Development in Wild-Type and hik-1/HIK;tes-1/TES Double Heterozygous Mutants.

Pre-fixed spores were stained with DAPI.

(A–E) Wild-type.

(F–J) double mutant pollen.

(A, F) early microspore stage, (B, G) late microspore, (C, H) early bicellular pollen, (D, I) mid-bicellular pollen, (E, J) tricellular pollen. Scale bars depict 10 µm.

 
In wild-type pollen, the highly condensed generative cell nucleus is initially lens-shaped at early bicellular stage, becomes round after being detached from the pollen wall and then elongates prior to pollen mitosis II (PMII). In contrast, the generative pole nucleus remained rounded in mutant binucleate pollen with partially dispersed chromatin (Figure 3D and 3I). While ~75% of pollen from double heterozygote plants showed a tricellular pollen phenotype, ~25% failed to enter PMII, leading to equivalent proportions of aborted pollen, and binucleate and uninucleate pollen arising from nuclear fusion (Figure 3E and 3J and Table 2).

We have reported very similar phenotypes in two-in-one (tio) mutants that are defective in cytokinesis at PMI (Oh et al., 2005). Incomplete cell plates detected with aniline-blue demonstrated that tio microspores initiate but fail to complete the cell plate. The similar defects in cytokinesis reported here suggest that microspores carrying mutant hik-1 and tes-1 alleles are also defective in cell plate expansion. Early bicellular stage pollen was stained with aniline-blue and the frequencies of fully expanded and unexpanded cell plates were counted for wild-type and double heterozygous plants. In wild-type plants at early bicellular stage, we observed ~91% of pollen with a curved, fully expanded cell plate (Figure 4A and 4B) and ~9% with unexpanded cell plates, most likely representing earlier stages of cytokinesis. In contrast, early bicellular stage pollen from double heterozygous plants showed a significant increase in the frequency (32%) of microspores with unexpanded cell plates (Figure 4C and 4D). This is close to the sum of the expected frequency (25%) of hik-1/tes-1 mutant microspores and the 9% of microspores with unexpanded cell plates observed at this stage in wild-type. This result demonstrates that the completion of cell plate expansion at PMI requires either HIK or TES. Moreover, it seems likely that both HIK and TES trigger the complete NACK–PQR pathway in microspores. Although this remains to be demonstrated unequivocally, Krysan et al. (2002) have reported that male and female gametes that are mutant in the three Arabidopsis orthologs of the tobacco MAPKKK NPK1 sequence are not transmitted, suggesting their essential role in gametophytic cytokinesis.


Figure 4
View larger version (43K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 4. Analysis of Nascent Cell Plates in Wild-Type and hik-1/HIK;tes-1/TES Double Heterozygous Mutant Pollen.

(A) Pollen at early bicellular stage was scored for the frequency of complete and incomplete cell plates after aniline–blue staining.

(B) A fully expanded cell plate from wild–type.

(C, D) Two examples of microspores with unexpanded cell plates from hik-1/HIK;tes-1/TES, double heterozygous mutants. Scale bar depicts 10 µm. All images are the same magnification.

 
The Individuality of Cytokinesis in Male Gametophytes
Tanaka et al. (2004) reported that atnack1(hik) and atnack2(tes) are not transmitted through both sexes and that cellularization in double mutant embryo sacs is defective. This demonstrated the functional redundancy of HIK and TES during female gametogenesis. Our data now provide direct evidence that HIK and TES play a redundant but essential role in cytokinesis during male gametogenesis. The redundancy of TES and HIK in gametophytic cellularization clearly indicates that these putative kinesins play equivalent roles in activating the NACK–PQR MAPKKK pathway during cell plate expansion. A redundant role has also been described for Arabidopsis kinesin motor proteins PAKRP1/Kinesin-12A and PAKRP1L/Kinesin-12B in organizing the anti-parallel phragmoplast array at PM I (Lee et al., 2007). Our results further suggest that gametophytic cellularizations are unique in their requirement for either TES or HIK. Certainly, TES cannot substitute for HIK in the sporophytic-type cytokinesis, and HIK and TES are not redundant in the meiotic divisions that give rise to the male gametophytes. Thus, our results extend the concept that different modes of cytokinesis are executed by a common NACK–PQR signaling pathway, but reinforce the individuality of gametophytic cytokinesis in its requirement for either TES or HIK.


   METHODS
TOP
 Abstract
 INTRODUCTION
 RESULTS AND DISCUSSION
 METHODS
SUPPLEMENTARY DATA
 FUNDING
 
Plant Materials and Growth Conditions
We used TES/tes-1 heterozygote (Ler-0) and HIK/hik-1 heterozygote (Col-0) plants in this study. Plants were grown under the conditions described previously (Park et al., 1998). Seeds of mutants are available without restriction.

RT–PCR Analysis
Different pollen developmental stages were separated and RNA was extracted as described previously (Honys and Twell, 2004). Synthesis of cDNA samples and RT–PCR reactions were performed as described (Honys and Twell, 2003). Primers were designed using Primer3 software (http://primer3.sourceforge.net/) to span at least one intron and to amplify similar length PCR products for both genes. Nucleotide sequences of the primers are as follows:

DHIKleft: 5'–ACCACAGGGGTCTGAGAAAGAGACT–3’
DHIKright: 5'–CTTCCATGTAGATTTGATCGGCTTG–3’
TES5’: 5'–CGAACAGCACTTGGCTGAGC–3’
TES3'G: 5'–GAGATGCAACAAGTTGGATATG–3’
NEW KAPP F: 5'–CGATGGCGATGATAGGATGAAC–3’
NEW KAPP R: 5'–GTAAAACCGTCCCTCAGTCAGAG–3’

Expected sizes for the cDNA PCR products are: HIK 458 nt; TES 405 nt; KAPP 296 nt. Expected sizes for the genomic DNA PCR products are: HIK 536 nt; TES 490 nt; KAPP 1440 nt. PCR reactions were repeated four times to confirm reproducibility of the results.

Genotyping HIK and TES Genes in Progenies of Double Heterozygote Plants
Genomic DNA was individually isolated from 52 progeny of double heterozygote plants. Wild-type plants of Col-0 and Ler-0 were used as controls. Gene-specific primers were used to amplify the HIK and the TES alleles. Allele-specific digestion patterns with restriction enzymes, DdeI for HIK and SacI for TES, enabled progeny to be genotyped.

Primer sequences used for genotyping: HIK5—ACGCCAAAAGCTTCAAGGGG; HIK3—GCTTCCTTGTGAATGGAGCC; TES5—CGAACAGCACTTGGCTGAGC; TES3—CGAACAGCACTTGGCTGAGC.

Microscopy
Isolation and morphological analysis of microspores and pollen after DAPI staining were carried out as described (Park et al., 1998). Aniline-blue staining of callosic cell plates in isolated microspores and pollen was carried out as described previously (Park et al., 2001).


   SUPPLEMENTARY DATA
TOP
 Abstract
 INTRODUCTION
 RESULTS AND DISCUSSION
 METHODS
 SUPPLEMENTARY DATA
FUNDING
 
Supplementary Data are available at Molecular Plant Online.


   FUNDING
TOP
 Abstract
 INTRODUCTION
 RESULTS AND DISCUSSION
 METHODS
 SUPPLEMENTARY DATA
 FUNDING
 
Biotechnology and Biological Research Council (91/18532, BB/E001017/1 to D.T. and H.G.D.). Korea Research Foundation Grant (KRF–532–F00008 to S.A.O.).


   Acknowledgements
 
We thank Georg Strompen for providing HIK/hik-1 mutant seeds and Maarten Donders for technical assistance. No conflict of interest declared.

    Brown RC, Lemmon BE. Pollen development in orchids 4: cytoskeleton and ultrastructure of the unequal pollen mitosis in Phalaenopsis. Protoplasma (1992) 167:183–192.[CrossRef][Web of Science]

    Dupl'áková N, Renák D, Hovanec P, Honysová B, Twell D, Honys D. Arabidopsis Gene Family Profiler (aGFP): user-oriented transcriptomic database with easy-to-use graphic interface. BMC Plant Biol. (2007) 7:39.[CrossRef][Medline]

    Eggert US, Mitchison TJ, Field CM. Animal cytokinesis: from parts list to mechanisms. Annu. Rev. Biochem. (2006) 75:543–566.[CrossRef][Web of Science][Medline]

    Honys D, Twell D. Comparative analysis of the Arabidopsis pollen transcriptome. Plant Physiol (2003) 132:640–652.[Abstract/Free Full Text]

    Honys D, Twell D. Transcriptome analysis of haploid male gametophyte development in Arabidopsis. (2004) Genome Biol. 5, R85.

    Jurgens G. Plant cytokinesis: fission by fusion. Trends Cell Biol. (2005) 15:277–283.[CrossRef][Web of Science][Medline]

    Krysan PJ, Jester PJ, Gottwald JR, Sussman MR. An Arabidopsis mitogen-activated protein kinase kinase kinase gene family encodes essential positive regulators of cytokinesis. Plant Cell (2002) 14:1109–1120.[Abstract/Free Full Text]

    Lee YR, Li Y, Liu B. Two Arabidopsis phragmoplast-associated kinesins play a critical role in cytokinesis during male gametogenesis. Plant Cell. (2007) 19:2595–605.[Abstract/Free Full Text]

    Oh SA, Johnson A, Smertenko A, Rahman D, Park SK, Hussey PJ, Twell D. A divergent role for the FUSED kinase family in the plant-specific cytokinetic phragmoplast. Curr. Biol. (2005) 15:2107–2111.[CrossRef][Web of Science][Medline]

    Otegui M, Staehelin LA. Cytokinesis in flowering plants: more than one way to divide a cell. Curr. Opin. Plant Biol (2000) 3:493–502.[CrossRef][Web of Science][Medline]

    Park SK, Twell D. Novel pattern of ectopic cell plate growth and lipid body distribution in the Arabidopsis gemini pollen1 mutant. Plant Physiol (2001) 126:899–909.[Abstract/Free Full Text]

    Park SK, Howden R, Twell D. The Arabidopsis thaliana gametophytic mutation gemini pollen 1 disrupts microspore polarity, division asymmetry and pollen cell fate. Development (1998) 125:3789–3799.[Abstract]

    Park SK, Rahman D, Oh SA, Twell D. gemini pollen 2, a male and female gametophytic cytokinesis defective mutation. Sex. Plant Reprod (2004) 17:63–70.[Medline]

    Nishihama R, et al. Expansion of the cell plate in plant cytokinesis requires a kinesin-like protein/MAPKKK complex. Cell. (2002) 109:87–99.[CrossRef][Web of Science][Medline]

    Soyano T, Nishihama R, Morikiyo K, Ishikawa M, Machida Y. NQK1/NtMEK1 is a MAPKK that acts in the NPK1 MAPKKK-mediated MAPK cascade and is required for plant cytokinesis. Genes Dev. (2003) 17:1055–1067.[Abstract/Free Full Text]

    Spielman M, Preuss D, Li FL, Brown WE, Scott RJ, Dickinson HG. TETRASPORE is required for male meiotic cytokinesis in Arabidopsis thaliana. Development (1997) 124:2645–2657.[Abstract]

    Staehelin LA, Hepler PK. Cytokinesis in higher plants. Cell. (1996) 84:821–824.[CrossRef][Web of Science][Medline]

    Strompen G, El Kasmi F, Richter S, Lukowitz W, Assaad FF, Jurgens G, Mayer U. The Arabidopsis HINKEL gene encodes a kinesin-related protein involved in cytokinesis and expressed in a cell-cycle-dependent manner. Curr. Biol. (2002) 12:153–158.[CrossRef][Web of Science][Medline]

    Takahashi Y, Soyano T, Sasabe M, Machida Y. A MAP kinase cascade that controls plant cytokinesis. J. Biochem. (2004) 136:127–132.[Abstract/Free Full Text]

    Tanaka H, Ishikawa M, Kitamura S, Takahashi Y, Soyano T, Machida C, Machida Y. The AtNACK1/HINKEL and STUD/TETRASPORE/AtNACK2 genes, which encode functionally redundant kinesins, are essential for cytokinesis in Arabidopsis. Genes to Cells (2004) 9:1199–1211.[Abstract/Free Full Text]

    Terasaka O, Niitsu T. The mitotic apparatus during unequal microspore division observed by a confocal laser scanning microscope. Protoplasma (1995) 189:187–193.[CrossRef][Web of Science]

    Twell D, Park SK, Hawkins TJ, Schubert D, Schmidt R, Smertenko A, Hussey PJ. MOR1/GEM1 has an essential role in the plant-specific cytokinetic phragmoplast. Nat. Cell Biol. (2002) 4:711–714.[CrossRef][Web of Science][Medline]

    Yang CY, Spielman M, Coles JP, Li Y, Ghelani S, Bourdon V, Brown RC, Lemmon BE, Scott RJ, Dickinson HG. TETRASPORE encodes a kinesin required for male meiotic cytokinesis in Arabidopsis. Plant J (2003) 34:229–240.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
1/5/794    most recent
ssn042v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Oh, S.-A.
Right arrow Articles by Twell, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?