Skip Navigation



Molecular Plant Advance Access published online on September 26, 2008

Molecular Plant, doi:10.1093/mp/ssn056
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
1/6/1036    most recent
ssn056v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Zhang, X.-C.
Right arrow Articles by Hu, J.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPP and IPPE, SIBS, CAS.

FISSION1A and FISSION1B Proteins Mediate the Fission of Peroxisomes and Mitochondria in Arabidopsis

Xin-Chun Zhanga and Jian-Ping Hua,b,1

a MSU–DOE Plant Research Laboratory, Michigan State University, East Lansing, MI 48824, USA
b Plant Biology Department, Michigan State University, East Lansing, MI 48824, USA

1 To whom correspondence should be addressed. E-mail huji{at}msu.edu, fax 517–353–9168, tel. 517-432-4620.


    Abstract
 TOP
 Abstract
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 FUNDING
 
Peroxisomes and mitochondria are metabolically diverse organelles that act in concert in a number of pathways in eukaryotes, including photorespiration and lipid mobilization in plants. The division machineries of these two types of organelles also share several components such as dynamin-related proteins (DRPs) and their organelle anchor, the FISSION1 (FIS1) protein. In Arabidopsis, members of the DRP3 and FIS1 small protein families, namely DRP3A, DRP3B, FIS1A, and FIS1B, are each dual-targeted to peroxisomes and mitochondria and are required for the division of both organelles; DRP3A and DRP3B are partially redundant in function. To further determine the contribution of FIS1A and FIS1B to the division of peroxisomes and mitochondria, we analyzed plants overexpressing FIS1A or FIS1B and mutants in which the functions of both proteins were disrupted. Domains in FIS1A and FIS1B required for peroxisomal targeting were also dissected. Our results demonstrate that FIS1A and FIS1B play rate-limiting and partially overlapping roles in promoting the fission of peroxisomes and mitochondria. Furthermore, although the C-terminus of FIS1 is both necessary and sufficient for targeting to peroxisomes, the role of the short C-terminal segment adjacent to the transmembrane domain may differ among diverse species in peroxisomal targeting.

Key Words: peroxisomal and mitochondrial fission • Arabidopsis • FIS1 protein

Received for publication June 30, 2008. Accepted for publication August 15, 2008.


    INTRODUCTION
 TOP
 Abstract
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 FUNDING
 
Peroxisomes are ER-derived and single-membrane eukaryotic organelles that mediate a variety of oxidative metabolic pathways (Beevers, 1979; Titorenko and Mullen, 2006; Van den Bosch et al., 1992). Plant peroxisomes play essential roles in many developmental and physiological processes, such as embryogenesis, oilseed germination, photorespiration, jasmonate biosynthesis, and metabolism of nitrogen and indole-butyric acid (Hayashi and Nishimura, 2003; Nyathi and Baker, 2006; Olsen and Harada, 1995; Reumann and Weber, 2006; Zolman et al., 2000). Peroxisomes are also called ‘organelles at the crossroads’, because, during metabolism, they often act in cooperation with other sub-cellular compartments within close physical proximity. For example, peroxisomes (glyoxysomes) in germinating oilseed seedlings interact with oil bodies and mitochondria and act coordinately with these two organelles and the cytosol during lipid mobilization; fatty acid β-oxidation and the glyoxylate cycle are crucial steps in the process, both taking place inside peroxisomes. In addition, leaf peroxisomes are also physically and functionally associated with chloroplasts and mitochondria through the glycolate recycling pathway during photorespiration (Beevers, 1979).

Peroxisomes are highly dynamic, capable of changing their complement, shape, and abundance in response to developmental and metabolic stimuli (Purdue and Lazarow, 2001). In plants, the abundance of peroxisomes can vary in response to environmental signals (de Felipe et al., 1988; Ferreira et al., 1989; Oksanen et al., 2003; Palma et al., 1991). Recently, we uncovered a phytochrome A-dependent signaling pathway that mediates the light-induced proliferation of peroxisomes in Arabidopsis seedlings (Desai and Hu, 2008). Plant peroxisomes, like their counterparts in animals and fungi, can multiply (from one to at least two peroxisomes) by division through several partially overlapping steps, namely, organelle elongation, membrane constriction, and fission (Fagarasanu et al., 2007; Yan et al., 2005). To dissect signaling pathways underlying the control of plant peroxisome abundance under various environmental influences, we need to first identify constituents of the machinery that controls the division of these organelles.

In Arabidopsis, the first step of peroxisome division, namely peroxisome elongation, is promoted by a five-member family of peroxisomal membrane proteins called PEROXIN11 (PEX11). Each AtPEX11 isoform, PEX11a to PEX11e, is able to induce peroxisome elongation and number increase (Lingard and Trelease, 2006; Nito et al., 2007; Orth et al., 2007). Despite our lack of knowledge of their precise biochemical function, we do know that PEX11 orthologs in diverse species play largely conserved roles (Fagarasanu et al., 2007; Thoms and Erdmann, 2005). In support of this idea, Arabidopsis PEX11c and PEX11e partially completed the growth phenotype of the null mutant of PEX11 in Saccharomyces cerevisiae (Orth et al., 2007).

A later step in peroxisome division, membrane fission, is governed by at least two types of dual-targeted proteins: dynamin-related proteins (DRPs) and FISSION1 (FIS1), which function coordinately. A subset of DRPs in yeast and animals is involved in the fission of peroxisomes and mitochondria (Hoepfner et al., 2001; Koch et al., 2003, 2004; Kuravi et al., 2006; Li and Gould, 2003; Schrader, 2006; Wilsbach and Payne, 1993) by serving as mechanochemical enzymes and/or signaling GTPases (Hoppins et al., 2007; Koch et al., 2004; Osteryoung and Nunnari, 2003; Praefcke and McMahon, 2004). Mammalian and yeast FIS1 proteins are C-terminal tail-anchored membrane proteins of peroxisomes and mitochondria, which use their cytoplasmically exposed N-terminal region containing the tetratricopeptide repeat (TPR) domain to interact with the DRPs and tether these proteins to the membrane (James et al., 2003; Kobayashi et al., 2007; Koch et al., 2003, 2005; Kuravi et al., 2006; Mozdy et al., 2000; Stojanovski et al., 2004; Yoon et al., 2003). In Arabidopsis, members of the DRP3 family, DRP3A and DRP3B, regulate peroxisomal fission in a partially redundant manner (Mano et al., 2004; Zhang and Hu, 2008); these two proteins are also involved in mitochondrial fission (Arimura et al., 2004; Arimura and Tsutsumi, 2002; Logan et al., 2004; Mano et al., 2004). The AtFIS1 family also includes two isoforms, FIS1A and FIS1B, which facilitate the division of both peroxisomes and mitochondria (Zhang and Hu, 2008; Scott et al., 2006). FIS1B was recently shown to be involved in cell cycle-associated replication of peroxisomes in Arabidopsis cell cultures, whereas FIS1A did not seem to play a role in this process (Lingard et al., 2008).

Yeast and mammals each have a single FIS1 protein (James et al., 2003; Kobayashi et al., 2007; Koch et al., 2003, 2005; Kuravi et al., 2006; Mozdy et al., 2000; Stojanovski et al., 2004; Yoon et al., 2003), whereas Arabidopsis contains two FIS1 variants. Our previous study showed that both FIS1A and FIS1B are dual-targeted to peroxisomes and mitochondria. In addition, T-DNA insertion mutant of FIS1A and RNAi lines of FIS1B both showed growth inhibition and contained peroxisomes and mitochondria with incomplete fission, enlarged size, and decreased numbers (Zhang and Hu, 2008). To further determine whether FIS1A and FIS1B each plays a specific role in the fission of peroxisomes and mitochondria, here we analyzed Arabidopsis plants ectopically expressing FIS1A or FIS1B and mutants in which the functions of both FIS1A and FIS1B were disrupted. We also dissected FIS1A and FIS1B to determine domains crucial for peroxisomal targeting, in order to compare targeting mechanisms utilized by FIS1 orthologs in plants and mammals.


    RESULTS
 TOP
 Abstract
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 FUNDING
 
Ectopic Expression of FIS1A and FIS1B Leads to an Increase in Peroxisomal and Mitochondrial Abundance
In our previous study of FIS1 localization, overexpression of YFP–FIS1A or YFP–FIS1B appeared to cause an increase in the number of peroxisomes and mitochondria, as well as aggregation of these organelles (Zhang and Hu, 2008). These results suggest a role for FIS1A and FIS1B as limiting factors in peroxisomal and mitochondrial division. However, we could not exclude the possibility that these phenotypes were rendered by a dominant negative effect of FIS1 proteins tagged with YFP, as YFP proteins on the surface of the organelles may interact with each other and interfere with the proper function of FIS1. To determine unequivocally the contribution of FIS1A and FIS1B to peroxisomal and mitochondrial fission and to see whether or not these two proteins have distinct functions in this process, we generated plants expressing untagged FIS1A or FIS1B under the control of the CaMV35S promoter (35S::FIS1). To visualize morphological changes of peroxisomes, we used plants containing the peroxisomal marker CFP–PTS1 (PEROXISOME TARGETING SIGNAL TYPE 1; a tripeptide consisting of Ser–Lys–Leu) as the background for transformation. This CFP–PTS1 line had been generated and characterized in the lab in previous studies (Fan et al., 2005; Orth et al., 2007).

We obtained 43 transgenic plants containing the 35S::FIS1A transgene and 47 plants expressing the 35S::FIS1B transgene. After RT–PCR and confocal laser scanning microscopic (CLSM) analyses of a subset of the transgenic plants, we selected two representative lines (Figure 1G) from the T3 generation for detailed imaging analysis. Both FIS1A- and FIS1B-overexpressing plants displayed markedly increased peroxisomal abundance; peroxisomal aggregation was more evident in the FIS1B-overexpressing plants (Figure 1A–1C). To quantify this increase, we used ImageJ software to measure the area of CFP fluorescence and the number of peroxisomes. For the measurements, we used 10 confocal images obtained from each genotype, 2500 µm2 per image. The area of CFP fluorescence in plants overexpressing FIS1A or FIS1B increased to approximately five to six times from that of the wild-type CFP–PTS1 plant (Figure 1H). Likewise, the number of peroxisomes also increased to about three-fold in the FIS1-overexpressing plants compared with the wild-type (Figure 1H).


Figure 1
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Overexpression of FIS1A and FIS1B Increases the Fission of Peroxisomes and Mitochondria.

(A–F) Confocal laser scanning microscopic images of leaf mesophyll cells (A–C) and leaf epidermal cells (D–F) from 4-week-old Arabidopsis plants expressing CFP–PTS1. In (A–C), green signals indicate CFP–PTS1-labelled peroxisomes; red signals indicate chloroplasts. In (D–F), fluorescent signals represent MitoTracker-stained mitochondria. Scale bars = 10 µm.

(G) RT–PCR analysis of RNA extracted from the respective FIS1-overexpressing plants. UBIQUITIN10 (UBQ10) is used as a loading control.

(H) Quantification of total fluorescence (CFP or MitoTracker) and organelle (peroxisome or mitochondrial) number per 2500 µm2 of the cells (n = 10, p < 0.05). Error bars are standard deviations.

 
We used the mitochondrial dye MitoTracker to stain leaf cells from the transgenic plants and subsequently examined changes in mitochondria using confocal microscopy. A significant increase in mitochondrial abundance was also shown in the FIS1-overexpressing plants (Figure 1D–1F). Quantification analysis showed a 1.5–2-fold increase in the area of MitoTracker fluorescence and the number of mitochondria in the transgenic plants compared with the wild-type, although these increases were not as dramatic as those seen for peroxisomes (Figure 1H).

Despite having a strong induction of peroxisomal and mitochondrial volume (measured by fluorescence area), plants ectopically expressing FIS1A or FIS1B did not exhibit obvious differences in appearance from the wild-type under normal growth conditions, nor did they have distinct germination or growth rate while germinating on agar plates supplemented with or without sucrose (data not shown). Thus, although elevated levels of FIS1A or FIS1B gave rise to significant increases in the abundance of peroxisomes and mitochondria, they did not cause obvious physiological changes to the plants.

FIS1A and FIS1B Are Partially Redundant in Promoting Organelle Fission
Single fis1 mutants, whose transcripts of FIS1A or FIS1B were undetectable by RT–PCR, showed similar phenotypes; they were slightly smaller than the wild-type plants and contained peroxisomes and mitochondria that were enlarged in size, reduced in number, and clustered together (Zhang and Hu, 2008). These findings indicate that the two homologous proteins FIS1A and FIS1B are not completely redundant in function and may each carry some unique roles in organelle fission. To further address this issue, a fis1A fis1B double mutant was needed. A T-DNA insertion mutant of FIS1A (SALK_086794) was characterized in previous studies and found to contain undetectable levels of the FIS1A mRNA (Scott et al., 2006; Zhang and Hu, 2008), but a fis1B knockout mutant was unavailable. Therefore, we created fis1A fis1B double mutants by using RNAi to silence FIS1B in the fis1A mutant background. The FIS1B RNAi construct was generated in our previous study and was proved to be effective in reducing FIS1B expression; the fis1A mutant expressing the YFP–PTS1 peroxisomal marker was generated in the same study (Zhang and Hu, 2008). We obtained 14 transgenic fis1A plants containing the full-length FIS1B RNAi transgene and showing various levels of FIS1B expression; two lines (R23 and R25) with strong reduction in FIS1B gene expression were selected for future analysis. R23 and R25 exhibited stronger growth inhibition than the fis1A single mutant (Figure 2A). RT–PCR analysis confirmed that the FIS1B gene was significantly silenced in these two lines (Figure 2B).


Figure 2
View larger version (52K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Plant Phenotype of fis1 Mutants.

(A) Plants grown for 3 weeks. R23 and R25 are fis1A plants in which the FIS1B gene is also silenced.

(B) RT–PCR analysis of RNA from R23 and R25.

 
We previously showed that, although the number of peroxisomes in the fis1A and fis1B single mutants was decreased, the total volume of these organelles, as measured by fluorescence area of the organelle markers, remained largely constant from the wild-type to the mutants (Zhang and Hu, 2008). These data suggest that plants can compensate in some way for the mild division deficiencies by increasing the size of individual peroxisomes. Here, we performed confocal microscopic analysis of YFP–PTS1 and MitoTracker signals in the double mutants. No major differences in peroxisomal and mitochondrial appearance and number were revealed between the double mutants and the fis1A single mutant parent throughout the development of the plants; images taken from 6-week-old plants are shown as examples (Figure 3). Both double mutants contained clumped and enlarged peroxisomes and mitochondria (Figure 3A–3H), similar to the phenotype shown in the fis1A mutant (Zhang and Hu, 2008; Figure 3). However, quantification data revealed that, although the number of these organelles was largely unchanged, the total volume of peroxisomes and mitochondria was slightly lower in the double mutants than in the fis1A single mutant (Figure 3I). Hence, the plant growth and organelle phenotypes collectively led us to conclude that FIS1A and FIS1B have overlapping and unique functions in controlling the division of mitochondria and peroxisomes.


Figure 3
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Peroxisomal and Mitochondrial Phenotypes of the fis1 Mutants.

(A–H) Confocal micrographs of leaf mesophyll cells (A–D) and leaf epidermal cells (E–H) from 6-week-old wild-type and fis1 mutant plants. All plants express the YFP–PTS1 peroxisomal marker gene. R23 and R25 are fis1A plants in which the expression of FIS1B is also reduced. In (A–D), green signals indicate YFP–PTS1; red signals are chloroplasts. In (E–H), fluorescent signals represent mitochondria stained by MitoTracker. Bars = 10 µm.

(I) Quantification of total YFP or MitoTracker fluorescence area and the number of peroxisomes or mitochondria in 2500 µm2 of the cells (n > 8, p < 0.05). Error bars are standard deviations.

 
Targeting of FIS1 Proteins to Peroxisomes
The C-terminal tail (aa 92–152) of hFIS1 is both necessary and sufficient for targeting this protein to peroxisomes and mitochondria in human cells (Koch et al., 2005). Furthermore, the transmembrane domain (TMD), along with a short basic segment at the C-terminal end, is essential for mitochondrial and peroxisomal targeting of hFIS1 (Koch et al., 2005; Stojanovski et al., 2004). In our previous study, we demonstrated in Arabidopsis that FIS1A and FIS1B, when tagged with YFP at the N-terminus (YFP–FIS1), were dual-targeted to peroxisomes and mitochondria, whereas FIS1 proteins with YFP fused to the C-terminus (FIS1–YFP) were mainly diffused in the cytosol and the nucleus, supporting the notion that the C-terminal end of the FIS1 proteins is important for proper organelle targeting in plants as well (Zhang and Hu, 2008). In light of these findings, questions arose as to what specific signals in the same FIS1 protein are being recognized by the different targeting machineries of peroxisomes and mitochondria, and whether FIS1 orthologs in diverse species utilize similar targeting mechanisms. As a first step toward answering these questions, we determined regions in the AtFIS1 proteins sufficient for peroxisomal targeting and tested whether the short basic segment downstream from the TMD is also essential for peroxisomal targeting in plants. Here, we chose to focus on the peroxisomal aspect of targeting because of our primary interest in this organelle.

Arabidopsis FIS1A and FIS1B proteins are 58% identical in amino acid sequence and contain predicted molecular weights of 18.7 and 17.9 kDa, respectively. They each share approximately 28% sequence identity with the 17-kDa human hFIS1 protein; an alignment of the Arabidopsis and human FIS1 proteins revealed strong conservation at the C-terminus, especially in the putative TMD (Figure 4A). Basic residues are also found to flank TMD at the 3’ end of the Arabidopsis FIS1 proteins: FIS1A has an arginine and two lysines (diK motif), whereas FIS1B contains only an arginine (Figure 4A). To determine sequences in the AtFIS1 proteins sufficient for peroxisomal targeting, we expressed in tobacco leaf epidermal cells a series of truncated FIS1A and FIS1B proteins, all of which were attached to the C-terminus of YFP. 35S promoter-driven truncated FIS1 constructs used in the analysis included: YFP–FIS1A/BNT (N-terminal half), YFP–FIS1A/BCT (C-terminal half), YFP–FIS1A/BTMD+CE (C-terminus including TMD and the adjacent C-terminal end), YFP–FIS1A{Delta}167–170, and YFP–FIS1B{Delta}166–167. Two days after inoculation of the FIS1 truncation constructs combined with CFP–PTS1 via Agrobacterial infiltration, expression of the YFP fusion proteins at expected molecular masses was confirmed by immunoblot analysis using an {alpha}-GFP antibody (Figure 4B).


Figure 4
View larger version (83K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. Sequence Alignment of FIS1 Proteins and Immunoblot Analysis of Truncated FIS1 Proteins Expressed in Tobacco Leaves.

(A) Alignment of Arabidopsis FIS1A and FIS1B and the human FIS1 proteins. The putative transmembrane domain (TMD) is underlined. Domains used in some of the truncation constructs are: FIS1ANT, aa 1–85; FIS1ACT, aa 86–170; FIS1BNT, aa 1–101; FIS1BCT, aa 102–167; FIS1ATMD+CE, aa 139–170; and FIS1BTMD+CE, aa 141–167. The boxed region indicates TMD+CE.

(B) Immunoblot analysis of proteins extracted from tobacco leaves co-expressing YFP fusions of truncated FIS1 proteins and the peroxisomal marker protein CFP–PTS1. Proteins were detected by the {alpha}-GFP antibody. Samples are: lane 1, protein marker; lane 2, tissue expressing CFP–PTS1 only; lanes 3–10, leaves co-expressing CFP–PTS1 and YFP–FIS1ANT, YFP–FIS1ACT, YFP–FIS1BNT, YFP–FIS1BCT, YFP–FIS1ATMD+CE, YFP–FIS1BTMD+CE, YFP–FIS1A{Delta}167–170, and YFP–FIS1B{Delta}166–167, respectively. Asterisks on the left of the protein bands point to the corresponding YFP–FIS1 fusions. The arrow indicates the position of the CFP–PTS1 protein band.

 
Co-localization of the YFP fusion proteins with the peroxisomal marker CFP–PTS1 was tested by confocal microscopy. Both YFP–FIS1ANT and YFP–FIS1BNT were present in the nucleus, cytosol, and possibly on the plasma membrane (Figure 5A and 5B), re-affirming that signals required for peroxisomal targeting do not reside in the N-terminal regions of the FIS1 proteins. In contrast, YFP–FIS1ACT and YFP–FIS1BCT showed punctate fluorescent signals largely co-localized with CFP–PTS1. However, increases in peroxisome number and aggregation, phenotypes caused by overexpressing YFP–FIS1A and YFP–FIS1B proteins (Zhang and Hu, 2008) or untagged FIS1 proteins (Figure 1), did not occur in cells overexpressing YFP–FIS1CT. These results are consistent with the view that the C-terminus of FIS1 proteins is necessary and sufficient for peroxisomal targeting, but is insufficient to confer protein function in promoting peroxisomal fission (Koch et al., 2005).


Figure 5
View larger version (27K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. The C-Terminus of FIS1A and FIS1B Is Sufficient for Peroxisomal Targeting.

Confocal images were taken from leaf epidermal cells of 4-week-old tobacco plants co-infiltrated with Agrobacteria containing CFP–PTS1 and YFP–FIS1 truncations. Bars = 10 µm.

 
YFP–FIS1ATMD+CE constructs were used to further delineate domains in the C-terminus of the FIS1 proteins sufficient for peroxisomal targeting. YFP–FIS1ATMD+CE contained the last 32 aa of FIS1A, whereas YFP–FIS1BTMD+CE contained the last 27 aa of FIS1B (Figure 4A). These two fusion proteins targeted to peroxisomes and possibly mitochondria, and to structures characteristic of the nucleus and plasma membrane (Figure 6A and 6B). Thus, the TMD domain and its 3’ flanking sequences seem to contain major signals required for peroxisomal targeting, but other sequences outside this region are also needed for efficient and accurate targeting to peroxisomes.


Figure 6
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 6. Analysis of the Role for TMD and Its Adjacent C-Terminal End of FIS1A and FIS1B in Peroxisomal Targeting.

Shown are confocal images of 4-week-old tobacco leaf epidermal cells co-expressing CFP–PTS1 and YFP fusions of FIS1 truncations. Bars = 10 µm.

 
The short C-terminal segment adjacent to the TMD was shown to be essential to peroxisomal and mitochondrial targeting of hFIS1 in human cells (Koch et al., 2005; Yoon et al., 2003). To determine whether the same region in AtFIS1 is also required for peroxisomal targeting in plants, we deleted this short stretch of sequence from the C-terminal end of the AtFIS1 proteins: YFP–FIS1A{Delta}167–170 was deleted for the last four amino acids (SRKK) of FIS1A and YFP–FIS1B{Delta}166–167 was deleted for the last two amino acids (RS) of FIS1B. Both proteins were largely targeted to small and spherical structures, many of which overlapped with CFP–PTS1, although localization to structures characteristic of the nucleus and plasma membrane was also evident (Figure 6C and 6D). These data suggest that the diK motif and other basic residues at the C-terminal end of Arabidopsis FIS1 are involved but not critical in the peroxisomal targeting of these proteins. As such, the role of the short C-terminal segment adjacent to the TMD may differ from plants to mammals in targeting FIS1 to peroxisomes.


    DISCUSSION
 TOP
 Abstract
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 FUNDING
 
Overexpressing myc–hFIS1 in human COS-7 cells led to a dramatic increase in the number of small and punctiform peroxisomes and a pronounced fragmentation of mitochondria (Koch et al., 2005; Yoon et al., 2003). Similarly, elevating levels of AtFIS1A and FIS1B also significantly increased the number of peroxisomes and mitochondria in plants (Figure 1). Thus, the function of FIS1 orthologs in the division of peroxisomes and mitochondria is well conserved in diverse species. In contrast to the dramatically elongated peroxisomes displayed in plants overexpressing each of the five Arabidopsis PEX11 proteins (Orth et al., 2007), plants overexpressing FIS1A or FIS1B primarily show completely divided and sometimes clumped peroxisomes. This fits with the model that PEX11 proteins are mainly responsible for the initial step of peroxisome division, namely peroxisome elongation, whereas FIS1 proteins are mediating a later step in the process, namely peroxisome fission. Both PEX11 and FIS1 proteins are apparently limiting factors in the division process: PEX11’s role is restricted to peroxisomes, whereas FIS1 proteins perform dual functions. Transcript levels of DRP3A, DRP3B, and PEX11ae remain largely constant from wild-type to the FIS1-overexpressing plants (data not shown), suggesting that ectopic expression of the FIS1 genes did not result in an induction of the DRP3 and PEX11 genes. Rather, higher levels of FIS1 proteins in the membranes of peroxisomes and mitochondria may directly lead to sequestration of more DRP3 proteins and possibly other downstream factors to these organelles to execute membrane severance.

Plants ectopically expressing FIS1A and FIS1B show slightly distinct peroxisome phenotypes. Peroxisomes in FIS1A-overexpressors tend to be more completed in fission than those in plants overexpressing FIS1B (Figure 1). This difference may reflect distinct roles of these two proteins in peroxisome fission. Consistent with this view is the fact that single mutants of FIS1A or FIS1B each have deficiency in peroxisomal (and mitochondrial) fission and are inhibited in growth (Zhang and Hu, 2008; this study). It is likely that each Arabidopsis FIS1 isoform may interact with specific downstream effector proteins such as DRPs in mediating the division of peroxisomes and mitochondria. This prediction, together with the notion that DRP3 and FIS1 physically interact, needs to be validated in Arabidopsis. Differences in the function of FIS1A and FIS1B have also been shown in Arabidopsis suspension cultured cells, whereby FIS1B but not FIS1A interacts with PEX11 and plays a role in cell cycle-associated peroxisome replication (Lingard et al., 2008). The fact that FIS1A plays different roles in cell cultures versus whole plants suggests that there may be cell type-specific factors in the protein targeting apparatus that determine the differential targeting and function of FIS1A.

Human cells with reduced levels of hFIS1 contain elongated and segmented peroxisomes that have been constricted but not separated (Koch et al., 2005). However, Arabidopsis mutants in which the functions of FIS1A, FIS1B, or both are disrupted are not elongated but rather are enlarged (Zhang and Hu, 2008; this study). Similarly, hFIS1 RNAi cells display extended mitochondrial tubules, whereas these organelles in the fis1 mutants in Arabidopsis are mostly enlarged in size (Zhang and Hu, 2008; Figure 3). This difference in peroxisomal and mitochondrial morphology in the mutants may reflect distinct mechanisms utilized by diverse species in coping with deficiencies in organelle division. It is somewhat surprising that our double mutants show only slightly stronger phenotypes than fis1A or fis1B single mutants (this study; Zhang and Hu, 2008), given that the expression of both genes was greatly reduced in these plants. We therefore speculate that other proteins with little sequence identity with FIS1 perform similar functions on the membrane of these two types of organelles.

Although FIS1 orthologs in different organisms exert conserved functions in peroxisomal fission, targeting signals in these proteins seem to be less conserved. For example, signals sufficient for peroxisome targeting reside in the C-terminal half of the FIS1 protein in both mammals and plants, yet the exact regions to which these signals are restricted seem to differ. The last 26 amino acids of hFIS1 were successfully targeted to peroxisomes and mitochondria (Koch et al., 2005), whereas AtFIS1 proteins containing the corresponding domain plus a few extra amino acids upstream (i.e. YFP–FIS1TMD+CE) target not only to peroxisomes, but also to the nucleus and the plasma membrane (Figure 6A and 6B). In addition, hFIS1 protein lacking the last five amino acids at the C-terminal end (SKSKS; Figure 4A) were diffused in the cytosol and failed to localize to peroxisomes (Koch et al., 2005). In contrast, AtFIS1 proteins missing the corresponding segment at the extreme C-terminus are still largely localized to peroxisomes (Figure 6C and 6D), suggesting that this small region is not essential for peroxisomal targeting in Arabidopsis. Previous studies of hFIS1 protein showed that the two lysine residues (diK motif; Figure 4A) at the extreme C-terminus are required for mitochondrial targeting, as replacing both lysine residues with alanines led to mis-targeting of the hFIS1 protein exclusively to the ER (Stojanovski et al., 2004). Given the targeting pattern of the C-terminal end-deleted Arabidopsis FIS1 proteins in our study, we predict that this C-terminal segment may not be essential for plant mitochondrial targeting, either. More detailed dissection of the C-terminal region is required to precisely locate residues required for FIS1 targeting to peroxisomes versus mitochondria in plants, because such information cannot be accurately derived from studies of FIS1 orthologs in other kingdoms. In fact, targeting mechanisms may even differ among different experimental systems of the same organism. For example, in Arabidopsis suspension cell cultures, neither myc–FIS1A nor myc–FIS1B on its own was able to target to peroxisomes labeled by {alpha}-catalase antibodies, but FIS1B was recruited to peroxisomes when co-overexpressed with a PEX11 protein (Lingard et al., 2008).

Peroxisomes and mitochondria—two sub-cellular compartments with different evolutionary origins, distinct structures, and unique metabolic function—share the same DRP and FIS1 proteins in their division machines. This fact may bear some physiological significance. Given that plant peroxisomes and mitochondria act in cooperation in two of the most important physiological processes in plants, lipid metabolism and photorespiration (Beevers, 1979), it is possible that these organelles also coordinate to some degree in multiplication in order to carry out these collaborative processes smoothly.

Taken together, our analysis of gain- and loss-of-function mutants of the Arabidopsis FIS1A and FIS1B genes and peroxisomal targeting analysis of truncated FIS1 proteins have revealed that FIS1 orthologs in diverse species contain conserved as well as unique features in their targeting mechanisms and in their roles as mediators in the fission of peroxisomes and mitochondria. To uncover additional and plant-specific features of organelle division, we need to perform further forward genetic and biochemical screens to identify novel components of the division machinery.


    METHODS
 TOP
 Abstract
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 FUNDING
 
Plant Growth
Seedlings (all in Col-0 background) were germinated under 16 h light (60 µE m–2 s–1)/8 h dark cycles and 21°C on plates containing 0.6% (w/v) agar, 1/2 Murashige and Skoog salt mixture (1/2MS), and 1% (w/v) sucrose. We transferred 2-week-old plants to soil and grew them under a photosynthetic photon flux density of 70–80 µmol m–2 s–1 at 21°C with 14-h light/10-h dark cycles. The wild-type plants expressing the YFP–PTS1 or CFP–PTS1 transgene were generated in previous studies (Desai and Hu, 2008; Fan et al., 2005; Orth et al., 2007). The fis1A mutant was characterized in a previous study (Zhang and Hu, 2008).

Construct Generation and Plant Transformation
We used the proofreading High-Phusion or Pfu DNA Polymerase (New England Biolabs Inc.) to amplify DNA fragments used for cloning of the overexpression constructs, with conditions suggested by the manufacturer. Primers used to amplify the FIS1 genes were: FIS1A forward GGGGTACCATGGATGCTAAGATC and reverse CGGGATCCTCATTTCTTGCGAGAC; and FIS1B forward GGGGTACCATGGACGCGGCGATAG and reverse ACGCGTCGACTTAGCTGCGTAATATG. The PCR products were digested by KpnI and BamHI for FIS1A and KpnI and SalI for FIS1B, and individually cloned into a binary vector containing the 35S promoter. The FIS1B RNAi construct was made in a previous study (Zhang and Hu, 2008).

A standard gateway cloning system (Invitrogen) was used to make the FIS1 truncation constructs. The Gateway®-compatible PCR products of FIS1 truncations were cloned into binary vectors containing a YFPattR1-CmrccdBattR2 integration region using One-Tube Format Protocol. Primers used in PCR amplifications are as follows:

YFP–FIS1ANT:

Forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGATGCTAAGATCGG
Reverse GGGGACCACTTTGTACAAGAAAGCTGGGTGTCAAGGGG CACTGCTTTC.

YFP–FIS1ACT:

Forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATG CCATTGGAGGACCG
Reverse GGGGACCACTTTGTACAAGAAAGCTGGGTGTCATTTCTTGCGAGACATCGC

YFP–FIS1BNT:

Forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTGATGGACGCGGCGATAGGG
Reverse GGGGACCACTTTGTACAAGAA AGCTGGGTG TTATCTTGAAAAGTCACC

YFP–FIS1BCT:

Forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTTC ATGAGCCGGGATTGTAT
Reverse GGGGACCACTTTGTACAAGAAAGCTGGGTGTTAGCTGCGTAATATGGCTGC

YFP–FIS1ATMD+CE:

Forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAAGGATGGTGTTATAG GG
Reverse GGGGACCACTTTGTACAAGAAAGCTGGGTGGCTTGCATGCCTGCAGGTCC

YFP–FIS1BTMD+CE:

Forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAAAGATGGTG TGATTGGC
Reverse GGGGACCACTTTGTACAAGAAAGCTGGGTGGCTTGCATGCCTGCAGGTCC

YFP–FIS1A{Delta}167–170:

Forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGATGCTAAGATCGG
Reverse GGGGACCACTTTGTACAAGAAAGCTGGGTTTTACATCGCTG CTACGATACC

YFP–FIS1B{Delta}166–167:

Forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGACGCGGCGATAGGG
Reverse GGGGACCACTTTGTACAAGAAAGCTGGGTTTTATAATATGGCTGCAGC AATAC.

The resulting constructs were transformed into Agrobacterium tumefaciens (C58C1) via electroporation. We used the floral-dip method (Clough and Bent, 1998) to transform the 35S::FIS1A/1B constructs into wild-type plants already expressing CFP–PTS1, and to transform the FIS1B RNAi construct into fis1A mutants already expressing YFP–PTS1. Stable primary transformants were selected on 1/2 MS medium containing kanamycin (50 µg ml–1; for 35S::FIS1) combined with gentamycin (60 µg mL–1; for CFP–PTS1) to select for FIS1-overexpressing plants, and kanamycin (50 µg ml–1; for YFP–PTS1) plus glufosinate ammonium (10 mg mL–1; Crescent Chemical, Augsburg, Germany, for FIS1B RNAi) to select for fis1A mutants containing the FIS1B RNAi transgene. For tobacco infiltration, Agrobacteria containing the YFP fusion constructs were co-infiltrated with CFP–PTS1 in leaves of 4-week-old Nicotiana tabacum (cv. Petit Havana) plants grown at 25°C (Goodin et al., 2002). The method for identification of plants in which FIS1B is silenced has been described previously (Zhang and Hu, 2008).

Reverse Transcription (RT)–PCR Analysis of Overexpression and RNAi Lines
We used an RNeasy Plant Mini Kit (Qiagen) to extract total RNA, using protocols suggested by the manufacturer. First-strand cDNA was synthesized using the Invitrogen Reverse Transcriptase, Superscript II (Invitrogen). We carried out PCR amplification using the following gene-specific primers: FIS1A (At3g57090) forward ATGGATGCTAAGATCGGACAATTC, reverse GCGAGACATCGCTGCTACGATACC; FIS1B (At5g12390) forward ATGGACGCGGCGATAGGGAAGGT, reverse GCTGCGTAATATGGCTGCAGCAA; and UBQ-10 (At4g05320) forward TCAATTCTCTCTACCGTGATCAAGATGCA, reverse GGTGTCAGAACTCTCCACCTCAAGAGTA. PCR conditions were: 95°C 2 min, 26 cycles of 95°C 30 s, 54°C 30 s, 72°C 1 min, and a final elongation step at 72°C for 10 min. Amplified DNA was run on 0.8% agarose gels.

Immunoblot Analysis
After 48 h of Agrobacterial infiltration, we ground N. tabacum leaf discs in liquid nitrogen and then suspended the leaf powder in 1 SDS–polyacrylamide gel electrophoresis (PAGE) sample buffer. The samples were boiled for 5 min, followed by centrifugation for 2 min. The supernatant was run on SDS–PAGE gels and transferred to Immobilon-P membrane for blotting (Millipore Corp., Bedford, MA). Primary antibody used to detect YFP and CFP proteins was a rabbit polyclonal GFP antibody (Santa Cruz Biotechnology, Inc.). The secondary antibody was goat anti-rabbit IgG (LI-COR Biosciences).

Confocal Laser Scanning Microscopy and Organelle Quantification
Confocal laser scanning microscopes (Zeiss Meta 510 or Zeiss Pascal) were used to obtain images of fluorescent proteins in plant cells. To detect YFP and CFP, plant tissue was mounted in water before analysis. For detection of mitochondria, leaves were first treated with 500 nM MitoTracker Red CMXRos (Mitochondrion-Selective Probes, Invitrogen) according to a previous study (Arimura and Tsutsumi, 2002). Lasers used for fluorophore excitation were: CFP, 458 nm; YFP, 514 nm; MitoTracker, 543 nm; and chlorophyll, 633 nm. For emission, the following filters were used: 465–510 nm band pass for CFP, 520–555 band pass for YFP, 560–614 band pass for MitoTracker, and 650 nm long pass for chlorophyll. All images were acquired from single optical sections.

ImageJ (http://rsb.info.nih.gov/ij/) was used to measure fluorescence area and organelle number in 50 x 50 µm confocal images. Confocal images obtained from CFP, YFP, or MitoTracker single channels were first converted to grayscale. The scale for measurement was based on scale bars on the confocal images. We used manual settings of the Threshold function to designate objects (organelles) to be measured or counted and the Analyze Particles function to measure fluorescence area and count the number of organelles. Organelles aggregated together without clear separation from each other were treated as a single one. The Excel program (Microsoft) was used to calculate standard deviations and statistical significance. For all organelle counting and fluorescence measurement shown in Figures 1 and 3, more than eight images from each plant were analyzed (p < 0.05).

Accession Numbers
Sequence data from this study can be found in the EMBL/GenBank data libraries under accession numbers: hFIS1, NP 057152; FIS1A, Q9M1J1 (At3g57090); FIS1B, Q94CK3 (At5g12390).


    FUNDING
 TOP
 Abstract
 INTRODUCTION
 RESULTS
 DISCUSSION
 METHODS
 FUNDING
 
This work was supported by grants from the US Department of Energy and the National Science Foundation (MCB 0618335) to J.H.


    Acknowledgements
 
We would like to thank Dr Sheng Quan for cloning of the 35S::FIS1A construct, Marlene Cameron for graphic assistance and Karen Bird for manuscript editing. No conflict of interest declared.

    Arimura S, Tsutsumi N. A dynamin-like protein (ADL2b), rather than FtsZ, is involved in Arabidopsis mitochondrial division. Proc. Natl Acad. Sci. U S A (2002) 99:5727–5731.[Abstract/Free Full Text]

    Arimura S, Aida GP, Fujimoto M, Nakazono M, Tsutsumi N. Arabidopsis dynamin-like protein 2a (ADL2a), like ADL2b, is involved in plant mitochondrial division. Plant Cell Physiol (2004) 45:236–242.[Abstract/Free Full Text]

    Beevers H. Microbodies in higher plants. Ann. Rev. Plant Physiol (1979) 30:159–193.[Web of Science]

    Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J (1998) 16:735–743.[CrossRef][Web of Science][Medline]

    de Felipe MR, Lucas MM, Pozuelo JM. Cytochemical study of catalase and peroxidase in the mesophyll of Lolium rigidum plants treated with isoproturon. J. Plant Physiol (1988) 132:67–73.[Web of Science]

    Desai M, Hu J. Light induces peroxisome proliferation in Arabidopsis seedlings through the photoreceptor phytochrome A, the transcription factor HY5 HOMOLOG, and the peroxisomal protein PEROXIN11b. Plant Physiol (2008) 146:1117–1127.[Abstract/Free Full Text]

    Fagarasanu A, Fagarasanu M, Rachubinski RA. Maintaining peroxisome populations: a story of division and inheritance. Annu. Rev. Cell Dev. Biol. (2007) 23:321–344.[CrossRef][Medline]

    Fan J, Quan S, Orth T, Awai C, Chory J, Hu J. The Arabidopsis PEX12 gene is required for peroxisome biogenesis and is essential for development. Plant Physiol (2005) 139:231–239.[Abstract/Free Full Text]

    Ferreira MB, Bird B, Davies DD. The effect of light on the structure and organization of Lemna peroxisomes. J. Exp. Bot (1989) 40:1029–1035.[Abstract/Free Full Text]

    Goodin MM, Dietzgen RG, Schichnes D, Ruzin S, Jackson AO. pGD vectors: versatile tools for the expression of green and red fluorescent protein fusions in agroinfiltrated plant leaves. Plant J (2002) 31:375–383.[CrossRef][Web of Science][Medline]

    Hayashi M, Nishimura M. Entering a new era of research on plant peroxisomes. Curr. Opin. Plant Biol. (2003) 6:577–582.

    Hoepfner D, van den Berg M, Philippsen P, Tabak HF, Hettema EH. A role for Vps1p, actin, and the Myo2p motor in peroxisome abundance and inheritance in Saccharomyces cerevisiae. J. Cell Biol. (2001) 155:979–990.[Abstract/Free Full Text]

    Hoppins S, Lackner L, Nunnari J. The machines that divide and fuse mitochondria. Annu. Rev. Biochem (2007) 76:751–780.[CrossRef][Web of Science][Medline]

    James DI, Parone PA, Mattenberger Y, Martinou JC. hFis1, a novel component of the mammalian mitochondrial fission machinery. J. Biol. Chem. (2003) 278:36373–36379.[Abstract/Free Full Text]

    Kobayashi S, Tanaka A, Fujiki Y. Fis1, DLP1, and Pex11p coordinately regulate peroxisome morphogenesis. Exp. Cell Res. (2007) 313:1675–1686.[CrossRef]

    Koch A, Schneider G, Luers GH, Schrader M. Peroxisome elongation and constriction but not fission can occur independently of dynamin-like protein 1. J. Cell Sci. (2004) 117:3995–4006.[Abstract/Free Full Text]

    Koch A, Thiemann M, Grabenbauer M, Yoon Y, McNiven MA, Schrader M. Dynamin-like protein 1 is involved in peroxisomal fission. J. Biol. Chem. (2003) 278:8597–8605.[Abstract/Free Full Text]

    Koch A, Yoon Y, Bonekamp NA, McNiven MA, Schrader M. A role for Fis1 in both mitochondrial and peroxisomal fission in mammalian cells. Mol. Biol. Cell. (2005) 16:5077–5086.[Abstract/Free Full Text]

    Kuravi K, et al. Dynamin-related proteins Vps1p and Dnm1p control peroxisome abundance in Saccharomyces cerevisiae. J. Cell Sci. (2006) 119:3994–4001.[Abstract/Free Full Text]

    Li X, Gould SJ. The dynamin-like GTPase DLP1 is essential for peroxisome division and is recruited to peroxisomes in part by PEX11. J. Biol. Chem. (2003) 278:17012–17020.[Abstract/Free Full Text]

    Lingard MJ, Trelease RN. Five Arabidopsis peroxin 11 homologs individually promote peroxisome elongation, duplication or aggregation. J. Cell Sci. (2006) 119:1961–1972.[Abstract/Free Full Text]

    Lingard MJ, Gidda SK, Bingham S, Rothstein SJ, Mullen RT, Trelease RN. Arabidopsis PEROXIN11c–e, FISSION1b, and DYNAMIN-RELATED PROTEIN3A cooperate in cell cycle-associated replication of peroxisomes. Plant Cell. 10.1105/tpc.107.057679 (2008).

    Logan DC, Scott I, Tobin AK. ADL2a, like ADL2b, is involved in the control of higher plant mitochondrial morphology. J. Exp. Bot (2004) 55:783–785.[Abstract/Free Full Text]

    Mano S, Nakamori C, Kondo M, Hayashi M, Nishimura M. An Arabidopsis dynamin-related protein, DRP3A, controls both peroxisomal and mitochondrial division. Plant J (2004) 38:487–498.[CrossRef][Web of Science][Medline]

    Mozdy AD, McCaffery JM, Shaw JM. Dnm1p GTPase-mediated mitochondrial fission is a multi-step process requiring the novel integral membrane component Fis1p. J. Cell Biol. (2000) 151:367–380.[Abstract/Free Full Text]

    Nito K, Kamigaki A, Kondo M, Hayashi M, Nishimura M. Functional classification of Arabidopsis peroxisome biogenesis factors proposed from analyses of knockdown mutants. Plant Cell Physiol (2007) 48:763–774.[Abstract/Free Full Text]

    Nyathi Y, Baker A. Plant peroxisomes as a source of signalling molecules. Biochim. Biophys. Acta (2006) 1763:1478–1495.

    Oksanen E, Haikio E, Sober J, Karnosky DF. Ozone-induced H2O2 accumulation in field-grown aspen and birch is linked to foliar ultrastructure and peroxisomal activity. New Phytol (2003) 161:791–799.[CrossRef][Web of Science]

    Olsen LJ, Harada J. Peroxisomes and their assembly in higher plants. Annu. Rev. Plant Biol. (1995) 46:123–146.[CrossRef][Web of Science]

    Orth T, et al. The PEROXIN11 protein family controls peroxisome proliferation in Arabidopsis. Plant Cell. (2007) 19:333–350.[Abstract/Free Full Text]

    Osteryoung KW, Nunnari J. The division of endosymbiotic organelles. Science (2003) 302:1698–1704.[Abstract/Free Full Text]

    Palma JM, Garrido M, Rodriguez-Garcia MI, del Rio LA. Peroxisome proliferation and oxidative stress mediated by activated oxygen species in plant peroxisomes. Arch. Biochem. Biophys (1991) 287:68–74.[CrossRef][Web of Science][Medline]

    Praefcke GJ, McMahon HT. The dynamin superfamily: universal membrane tubulation and fission molecules? Nat. Rev. Mol. Cell Biol. (2004) 5:133–147.[CrossRef][Web of Science][Medline]

    Purdue PE, Lazarow PB. Peroxisome biogenesis. Annu. Rev. Cell Dev. Biol. (2001) 17:701–752.[CrossRef][Web of Science][Medline]

    Reumann S, Weber AP. Plant peroxisomes respire in the light: some gaps of the photorespiratory C2 cycle have become filled––others remain. Biochim. Biophys. Acta (2006) 1763:1496–1510.

    Schrader M. Shared components of mitochondrial and peroxisomal division. Biochim. Biophys. Acta (2006) 1763:531–541.

    Scott I, Tobin AK, Logan DC. BIGYIN, an orthologue of human and yeast FIS1 genes functions in the control of mitochondrial size and number in Arabidopsis thaliana. J. Exp. Bot (2006) 57:1275–1280.[Abstract/Free Full Text]

    Stojanovski D, Koutsopoulos OS, Okamoto K, Ryan MT. Levels of human Fis1 at the mitochondrial outer membrane regulate mitochondrial morphology. J. Cell Sci. (2004) 117:1201–1210.[Abstract/Free Full Text]

    Thoms S, Erdmann R. Dynamin-related proteins and Pex11 proteins in peroxisome division and proliferation. FEBS J (2005) 272:5169–5181.[CrossRef][Medline]

    Titorenko VI, Mullen RT. Peroxisome biogenesis: the peroxisomal endomembrane system and the role of the ER.J. Cell Biol (2006) 174:11–17.

    Van den Bosch H, Schutgens R, Wanders R, Tager J. Biochemistry of peroxisomes. Annu. Rev. Biochem (1992) 61:151–197.

    Wilsbach K, Payne GS. Vps1p, a member of the dynamin GTPase family, is necessary for Golgi membrane protein retention in Saccharomyces cerevisiae. EMBO J (1993) 12:3049–3059.[Web of Science][Medline]

    Yan M, Rayapuram N, Subramani S. The control of peroxisome number and size during division and proliferation. Curr. Opin. Cell Biol. (2005) 17:376–383.

    Yoon Y, Krueger EW, Oswald BJ, McNiven MA. The mitochondrial protein hFis1 regulates mitochondrial fission in mammalian cells through an interaction with the dynamin-like protein DLP1. Mol. Cell Biol. (2003) 23:5409–5420.[Abstract/Free Full Text]

    Zhang X, Hu J. Two small protein families, DYNAMIN-RELATED PROTEIN 3 and FISSION 1, are required for peroxisome fission in Arabidopsis. Plant J. in press (2008).

    Zolman BK, Yoder A, Bartel B. Genetic analysis of indole-3–butyric acid responses in Arabidopsis thaliana reveals four mutant classes. Genetics (2000) 156:1323–1337.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
1/6/1036    most recent
ssn056v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Zhang, X.-C.
Right arrow Articles by Hu, J.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?